ID: 1059739273

View in Genome Browser
Species Human (GRCh38)
Location 9:117133947-117133969
Sequence AGATAGTTATAGGGGTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059739273_1059739278 -9 Left 1059739273 9:117133947-117133969 CCTTGTAACCCCTATAACTATCT 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1059739278 9:117133961-117133983 TAACTATCTCATGGTTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059739273 Original CRISPR AGATAGTTATAGGGGTTACA AGG (reversed) Intronic
903209402 1:21808305-21808327 AGGGTGTTACAGGGGTTACAGGG + Intergenic
903507219 1:23846085-23846107 AGGTAGTTATGGGGGATTCAAGG + Exonic
906478847 1:46187432-46187454 AGAGAGTTACAGGGGTCAAAGGG - Intergenic
916192925 1:162196776-162196798 AGATTGATATAGGGGTTGCTTGG + Intronic
922058612 1:222065694-222065716 AGATGGTTATAAAGATTACATGG - Intergenic
922060561 1:222086925-222086947 AGATATTTAAAGAGGTTAAAAGG + Intergenic
922437130 1:225617406-225617428 AGATAGAAATTGGGGTTACTAGG + Intronic
924039018 1:239965196-239965218 AGATAGTTTTTGGGTTAACAAGG + Intergenic
1066613873 10:37277280-37277302 AGATAGTATTTGTGGTTACAGGG + Intronic
1067232132 10:44419359-44419381 AGATAATTATGGGGGTTCAAAGG + Intergenic
1067364581 10:45613545-45613567 AGATAATTTTAGGTATTACATGG - Intergenic
1067563712 10:47321880-47321902 AGATAGTTATAGGGGTTAAGAGG - Intergenic
1070189253 10:74096482-74096504 AGATAATTTTAGGTGTTACATGG - Intronic
1073383200 10:103097603-103097625 ACATATTTATAGGGGTTATATGG + Intronic
1073710049 10:106026273-106026295 AGAGAGTTATAGGGAGTAAATGG + Intergenic
1074447307 10:113531009-113531031 AGAAAGATGTTGGGGTTACATGG + Intergenic
1075774516 10:124972483-124972505 AGATAGCTATATTGGTTACCTGG + Intronic
1076490243 10:130855852-130855874 TGATTGTCATAGTGGTTACATGG + Intergenic
1078141665 11:8697741-8697763 TGATAGTTATGAGGGTTACTGGG - Intronic
1078828762 11:14957556-14957578 TGATAGTTACATGGGTTAGATGG + Intronic
1080181278 11:29429342-29429364 AGAAAGTTAAAGAGGATACAAGG - Intergenic
1081259559 11:40942893-40942915 AGTTAGTAATAGGGGTTATGGGG - Intronic
1089188093 11:116634670-116634692 AGTTTGTTATAGCAGTTACATGG - Intergenic
1090489110 11:127142315-127142337 AGATTGATATTGGGGTTGCAGGG + Intergenic
1093345977 12:18038644-18038666 AGATAGTATTCGTGGTTACAGGG - Intergenic
1094765692 12:33592119-33592141 AGATATTTAAAGGGTTTAAAAGG + Intergenic
1096408669 12:51361873-51361895 AGATAGGTTCTGGGGTTACAGGG - Intronic
1096982749 12:55737767-55737789 AGATAATTATAGGATTTAGAAGG + Intergenic
1098584062 12:72135481-72135503 AGACAGTTATAGGGCTAGCAAGG - Intronic
1108412151 13:50160603-50160625 AGATAGTCATAGGTCTTCCAAGG + Intronic
1111925858 13:94462757-94462779 AGACAGTGAGAGGGTTTACAAGG + Intronic
1118269210 14:64326791-64326813 AGAAAGGTATAGGGGTAATAGGG - Intronic
1120252516 14:82076240-82076262 AATTAGTTTTAGTGGTTACATGG + Intergenic
1126341911 15:47650355-47650377 ACATAGTTATAGCGGTTTCTTGG - Intronic
1136315615 16:29453271-29453293 AGAAAGTGATCGGGGTTTCAGGG - Intronic
1136430192 16:30192613-30192635 AGAAAGTGATCGGGGTTTCAGGG - Intergenic
1136541900 16:30932325-30932347 AGATAGTTACAGAAGTTGCAGGG + Intronic
1140168233 16:72576733-72576755 AGATAGTTATGAGTGTTATAAGG + Intergenic
1141307264 16:82877117-82877139 AGATATTTATAGGGCTTGTAGGG + Intronic
1148252322 17:46094463-46094485 AGAGGGTTATGGGGGTTACGAGG + Intronic
1151046619 17:70927725-70927747 GGCTAGTTATAGAGGTTAAAAGG + Intergenic
1151628629 17:75294533-75294555 AGATAGTTAAAGGTGTTGCCGGG + Intergenic
1153969710 18:10215220-10215242 TGATATTTACATGGGTTACAGGG + Intergenic
1156175073 18:34534537-34534559 AGATAGGTATACGTGTTCCATGG + Intronic
1163846703 19:19642291-19642313 AAATATTTTAAGGGGTTACAAGG + Intronic
1168479571 19:56707786-56707808 AGATAGTTATTTGTGTTGCAGGG + Intergenic
1168479576 19:56707855-56707877 AGATAGTTATTTGTGTTGCAGGG + Intergenic
1168479582 19:56707924-56707946 AGATAGTTATTGGTGTTGCAGGG + Intergenic
926945220 2:18180256-18180278 AGAGAGTGAGAGGGGTTAAAGGG - Intronic
929007153 2:37406909-37406931 ATATTTTTATAGGGGTTGCATGG + Intergenic
929224585 2:39500002-39500024 AGTTTGTTAAAGAGGTTACACGG - Intergenic
929716182 2:44312669-44312691 AGTAAGTTATAGGAGTTCCAGGG - Exonic
930035578 2:47083371-47083393 AGACAGTTGTAGGGGCTCCAAGG - Intronic
936109200 2:109651138-109651160 AGATAGGTACAGGGGTTGCTGGG - Intergenic
936767665 2:115873229-115873251 AGAGAGATTTAGGGGTTACCAGG - Intergenic
941186696 2:162327459-162327481 AGATAATTATAAGGATTAAAAGG - Intronic
941648937 2:168072289-168072311 TGATAGTTACAGGGGTGAAAAGG + Intronic
944525001 2:200610055-200610077 AGATAGTTTTATGGTTTAAATGG - Intronic
944655166 2:201870242-201870264 AGATAGTGGTGGTGGTTACAGGG - Intronic
944663973 2:201944034-201944056 CGATGGTTTTAGGGGTTAAAGGG - Intergenic
944735694 2:202561605-202561627 AGATAGTTCCAGGGATTAAAAGG + Exonic
944751789 2:202716623-202716645 GAATAGTTATAGGCCTTACAAGG - Intronic
945461126 2:210110127-210110149 AGGTAGGTATAGGGGTTAGAGGG - Intronic
1169698727 20:8422481-8422503 ATATATTGATAGGGGTTACATGG + Intronic
1169710437 20:8555580-8555602 AGATATTTATAGGAAATACATGG - Intronic
1170673564 20:18457552-18457574 AGCTAGGTATAGGGGTGTCATGG + Intronic
1177720183 21:24895661-24895683 AGATAGTTATAGGAACCACAGGG + Intergenic
1177872356 21:26589065-26589087 AGATAGTGATAAGTGTTATATGG - Intergenic
957381256 3:79433071-79433093 ACATAGTTAAATGGGTTCCATGG + Intronic
958567152 3:95828935-95828957 ATTTATTTTTAGGGGTTACAAGG + Intergenic
962775238 3:138652850-138652872 AGATATATATATGGGGTACATGG - Exonic
964555850 3:157937333-157937355 AGATAGATATAGAACTTACATGG + Intergenic
971533891 4:27723492-27723514 AGATAGTTATAGATTTTATAAGG + Intergenic
972736229 4:41844365-41844387 GGATAGTTGTAGGGATTAAATGG - Intergenic
974657861 4:64848597-64848619 AGATGGTTACAGGGTTTTCAAGG + Intergenic
975903877 4:79186717-79186739 AAATATTTATAGGAGTTCCAAGG + Intergenic
977660667 4:99581464-99581486 AGGTAGTTTTAGTGGTTAGAAGG - Intronic
977884877 4:102243446-102243468 AGATAGTATTCGTGGTTACAGGG - Intergenic
979651170 4:123133381-123133403 AGATTGTTACAGGAGTCACAAGG - Intronic
981353384 4:143758087-143758109 ACATAGGTATAGGTGTTCCATGG - Intergenic
984289109 4:177770573-177770595 AGATAGCTCTAGGGGTAATAAGG - Intronic
986230030 5:5854884-5854906 AGAAATTTATAGGGGTTACTTGG + Intergenic
993482069 5:88436053-88436075 AGATAATTTTAGTAGTTACAGGG + Intergenic
996143371 5:119942676-119942698 AGCTAGTTAGAGGTGATACAAGG - Intergenic
996273331 5:121635633-121635655 ACATAGTTATTGGGCTTACAAGG - Intergenic
1000855780 5:166396338-166396360 AGATGGGTAAAGAGGTTACATGG - Intergenic
1004749049 6:18541727-18541749 AGAGAGTTATATGGGTTAGAAGG + Intergenic
1008094597 6:47326886-47326908 AGAAAGTTATAGAAGTTACCAGG + Intergenic
1011723478 6:90184028-90184050 AAATAGCTATAGAGGTTATATGG - Intronic
1013357274 6:109357241-109357263 AGATACTTTTAGGGGTATCATGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1015654972 6:135507535-135507557 AGATAAATAAAGGGCTTACAAGG + Intergenic
1020493614 7:8820631-8820653 AGATAGAAATAATGGTTACATGG + Intergenic
1020989210 7:15175497-15175519 ATATAGAAATAGGGATTACATGG - Intergenic
1023100300 7:36711174-36711196 AAATAGTCATAGTGATTACATGG - Intronic
1023360848 7:39414063-39414085 AGAAAGTTAAAGGGGTTGCTGGG - Intronic
1028166360 7:87542018-87542040 AGATAGTTATAAGGGCTAATAGG + Intronic
1031599713 7:123692128-123692150 ATATAGAGATATGGGTTACATGG + Intronic
1033394885 7:140964140-140964162 AAATAGATTTAGGGGGTACATGG - Intergenic
1033663300 7:143418526-143418548 AGATGGTCATAGGGGTTGGATGG + Intergenic
1033829157 7:145231595-145231617 AGAAAGGTAAAGGGGATACAAGG + Intergenic
1038032994 8:23661270-23661292 AGATGGTAATAGGAGTGACAGGG + Intergenic
1039445439 8:37627817-37627839 GGATAGTTATATGTATTACATGG - Intergenic
1040854147 8:51931658-51931680 AAAGAGTTATAGGGATTTCAGGG + Intergenic
1041964424 8:63658525-63658547 AGAATGTTCTAGGAGTTACATGG + Intergenic
1046966152 8:120168062-120168084 AGATACTTTTAGGGCTTTCAAGG + Intronic
1047629385 8:126690478-126690500 AGGCAGTTCTAGGTGTTACATGG + Intergenic
1051427081 9:16943071-16943093 GGATAATTATATGGGTTACCTGG - Intergenic
1053724673 9:40987319-40987341 AGATAATTATAGGGCTAAAAGGG + Intergenic
1053729877 9:41042744-41042766 TGATTGTGATAGTGGTTACATGG + Intergenic
1054341298 9:63864680-63864702 AGATAATTATAGGGCTAAAAGGG - Intergenic
1055163710 9:73164499-73164521 ATATATTTATGGAGGTTACATGG + Intronic
1056684030 9:88744909-88744931 AGATATTAATAGGAGTTTCAGGG + Intergenic
1059739273 9:117133947-117133969 AGATAGTTATAGGGGTTACAAGG - Intronic
1186207442 X:7215554-7215576 GGATAGGTAGAGGGGTTCCAGGG - Intergenic
1187539813 X:20181520-20181542 AGATAGTAATAGGAGATATAAGG - Intronic
1188943007 X:36263508-36263530 AGATAGTTATTGGCCTTAAAGGG - Intronic
1189280445 X:39817138-39817160 AGATAGTTTTAGGAGTCAGAGGG + Intergenic
1192022148 X:67404854-67404876 ATATATATTTAGGGGTTACATGG - Intergenic
1192416063 X:70981830-70981852 TGATAGTTAGAGGGATTATAAGG - Intergenic
1192960426 X:76124666-76124688 AGATTGGTATAGTGGTTTCAAGG + Intergenic
1197726321 X:129779279-129779301 CGATGGTTATAGGGGTGAGAGGG + Intergenic
1198788990 X:140322051-140322073 AGATTGTTATAGCTGTTATATGG - Intergenic
1199271244 X:145884937-145884959 AGATAGTAATAGGGATTAATAGG + Intergenic
1201495974 Y:14591758-14591780 AGATAGTGTTCGTGGTTACAAGG + Intronic