ID: 1059740216

View in Genome Browser
Species Human (GRCh38)
Location 9:117142854-117142876
Sequence CTGGAGACACAGATGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 761
Summary {0: 1, 1: 0, 2: 5, 3: 79, 4: 676}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059740216 Original CRISPR CTGGAGACACAGATGGAGGG AGG (reversed) Intronic
900161437 1:1225907-1225929 CTGAAGACACGGCTGCAGGGCGG + Intronic
900416146 1:2535628-2535650 CTGGAGCTCCAGATGGTGGGTGG + Intergenic
900485707 1:2921692-2921714 CTGGATGGACAGATGGACGGAGG - Intergenic
900485716 1:2921734-2921756 CTGGATGGACAGATGGACGGAGG - Intergenic
900485725 1:2921776-2921798 CTGGATGGACAGATGGACGGAGG - Intergenic
900485735 1:2921818-2921840 CTGGATGGACAGATGGACGGAGG - Intergenic
900485744 1:2921860-2921882 CTGGATGGACAGATGGACGGAGG - Intergenic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900648200 1:3718401-3718423 CCGGAGACCCAGAGGGAGTGGGG + Intronic
900993571 1:6108734-6108756 ATGGAGAGACAGAGGGATGGAGG + Intronic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901059422 1:6465294-6465316 CTGGAGAGAAAGAGGGAGGGAGG - Intronic
901127441 1:6939565-6939587 CTGGAGACAGAGAGGACGGGAGG - Intronic
902077013 1:13795379-13795401 CTGAAGTCACAGATGGTAGGAGG + Intronic
902379120 1:16044463-16044485 CTGGAGAAGCGGATAGAGGGAGG - Intronic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
902724650 1:18326718-18326740 AGGGAGGGACAGATGGAGGGAGG - Intronic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903281109 1:22250485-22250507 CTGGTGACTCAGATGGGGAGGGG + Intergenic
903464890 1:23545219-23545241 CTGGAGCCACAGCTGCAAGGTGG + Intergenic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
904654036 1:32029073-32029095 ATGGAGAGGCAGATGAAGGGAGG - Intronic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
905133924 1:35783332-35783354 TTGGAGTCCCAGATGGAGAGGGG - Intergenic
905212819 1:36385979-36386001 CTGGAGACGCAGGCGGAGGGCGG - Intergenic
905232357 1:36522142-36522164 CTGGAGACCCAGTCTGAGGGGGG - Intergenic
906607213 1:47180974-47180996 AGGGAGACAGAGATGGATGGAGG + Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907293429 1:53433417-53433439 GTAGAGACACAGAGGGCGGGGGG - Intergenic
907466371 1:54640456-54640478 CTGGAGATAAAGAGTGAGGGAGG + Intergenic
907564926 1:55425748-55425770 CCAGAGACAGGGATGGAGGGAGG - Intergenic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
908326343 1:63027615-63027637 GTGGACACCCAGATTGAGGGTGG - Intergenic
909877547 1:80828158-80828180 ATGGAGGCCCAGATTGAGGGTGG - Intergenic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
912204164 1:107492319-107492341 CTGGTGACACAGCTGCAGAGAGG + Intergenic
912521325 1:110246923-110246945 ATGGAGACTCAGAGGGAGAGAGG - Intronic
913099395 1:115549379-115549401 GTAGAGACACAGAAGGAGGGGGG + Intergenic
913540119 1:119811437-119811459 CTGGAGACACTGAAGAAGGCAGG - Exonic
914802526 1:150971995-150972017 CTGGAGTCGCAGAGGGAGGGTGG + Intronic
914964089 1:152237704-152237726 CAGGAGAAAGAGATGGGGGGAGG - Intergenic
915940265 1:160114396-160114418 CTGGGCACAGAGATGGAGTGAGG - Intergenic
916499378 1:165373804-165373826 CTGGGGCCAGAGATGGTGGGAGG - Intergenic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
917598310 1:176551912-176551934 TTGGAGGCAGAGATGCAGGGAGG + Intronic
918102156 1:181385795-181385817 ATGGAGAAACGGAGGGAGGGAGG - Intergenic
918203779 1:182291296-182291318 CAGGAAATACATATGGAGGGGGG + Intergenic
918982111 1:191575794-191575816 CTGCAGAGAAAGATGAAGGGAGG + Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919718516 1:200806673-200806695 CTGAAGAAACTGGTGGAGGGAGG + Intronic
920164598 1:204026600-204026622 CTGGAGACAAAGGCAGAGGGAGG + Intergenic
920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG + Intergenic
920267017 1:204731589-204731611 CTGGTGAGAGAGATGGAGAGAGG - Intergenic
922162713 1:223090157-223090179 CTGGAGAGCCAGATGAGGGGAGG - Intergenic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922637164 1:227185644-227185666 CTACAGAGACAGAGGGAGGGGGG - Intronic
923036274 1:230287203-230287225 ATGGTGACACAGGTGGTGGGTGG - Intergenic
923988894 1:239412337-239412359 CTGGAGGAAAAGAGGGAGGGAGG - Intronic
924673624 1:246153398-246153420 CTGGAGATAGGGAAGGAGGGAGG + Intronic
1062836004 10:636073-636095 CTGGAAACACACATGTAGTGTGG - Intronic
1063016108 10:2079361-2079383 ATGAAGACACAGAAGGAAGGGGG - Intergenic
1063203231 10:3806142-3806164 CTGCAGACACACCTGGAGGGAGG + Intergenic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063703211 10:8405777-8405799 CTTGGGACACACTTGGAGGGAGG + Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1063953437 10:11244892-11244914 CACCAGACACAGATGGAGGAAGG - Intronic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064492170 10:15870564-15870586 CAGGAGGCAAAGGTGGAGGGTGG + Intergenic
1064598802 10:16972755-16972777 CTGGTGATAGAGATGGTGGGGGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1065995412 10:31055532-31055554 CAGGAGAGACAGAGTGAGGGGGG + Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067572724 10:47383788-47383810 CGGGAGAGACAGTGGGAGGGAGG + Intronic
1067787691 10:49262617-49262639 CTGGCCACACAGATGGGGTGAGG + Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068955119 10:62814727-62814749 CTAGAGCCACAGATGGCTGGGGG - Intronic
1069038499 10:63670308-63670330 CAGGAGCCAAAGAGGGAGGGAGG - Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1070976251 10:80608281-80608303 CTGAAGGCACAGAGGGCGGGAGG + Intronic
1072070406 10:91909590-91909612 CTGGAGAGACAGAGAGAGAGAGG - Intergenic
1073061973 10:100738604-100738626 TTGAAGAAACTGATGGAGGGAGG - Intronic
1073148025 10:101293023-101293045 CTGGAGAGACACAGGGTGGGTGG - Intergenic
1073357601 10:102869670-102869692 CTCGAGACACAGCTCGGGGGAGG - Intronic
1073423615 10:103443052-103443074 CTGAGGACACAGATAGAGGCTGG + Intronic
1073428409 10:103470541-103470563 GTGGAAAGAAAGATGGAGGGAGG - Intergenic
1073560903 10:104496037-104496059 CTGGGGCCACATATGGAGGGAGG - Intergenic
1073688975 10:105786486-105786508 ATGGAGACACAGAGAGAAGGTGG - Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1075948336 10:126456740-126456762 ATAGAGACACAGACGCAGGGAGG + Intronic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076471533 10:130722115-130722137 CTGAAGGCAAGGATGGAGGGAGG + Intergenic
1076614451 10:131746665-131746687 CTGGGGACAGAGCTGGGGGGAGG + Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076799158 10:132812638-132812660 CTGCAGTCACAGAGGGTGGGGGG + Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077163861 11:1126375-1126397 ATGGGGACACACATGGATGGTGG + Intergenic
1077452018 11:2654104-2654126 GTGGAGACACAGGTGGTGGCGGG + Intronic
1079122445 11:17695701-17695723 CTGAGGACAGAGATGGAGGCCGG + Intergenic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG + Intronic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080627418 11:34043075-34043097 CAGGAGAGACAGAGTGAGGGTGG + Intergenic
1081105197 11:39058512-39058534 GTGCAGATTCAGATGGAGGGAGG - Intergenic
1081222839 11:40483236-40483258 CTGGAGACAAAGCTAGAGGGAGG + Intronic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1081625423 11:44652466-44652488 CTGGAGACAGGTTTGGAGGGTGG + Intergenic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1081961075 11:47137948-47137970 CTGAAGATAGAGTTGGAGGGTGG + Intronic
1081961250 11:47139214-47139236 CTGAAGACAGAGTTGGAGGGTGG + Intronic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1083840018 11:65299086-65299108 CTGGTGACACAGCTGAAGTGGGG - Intronic
1083894767 11:65614266-65614288 CGGGAGGCAGAGGTGGAGGGTGG + Intronic
1084461823 11:69300437-69300459 CTGGAGACAGAGAGGGGTGGAGG + Intronic
1084740004 11:71133410-71133432 ATGGATGGACAGATGGAGGGAGG + Intronic
1084941073 11:72613652-72613674 CTGGAGACACAGGAGTAGGTGGG - Intronic
1084942808 11:72622687-72622709 CTGGAGACAGAGGAGGATGGGGG + Intronic
1085035320 11:73296558-73296580 CGGTAGACACAGGTGGTGGGTGG - Exonic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085738585 11:79060632-79060654 CTGCAGACTCAAATGGAGGCAGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1087657975 11:100949250-100949272 CTGGTAACACAGTTTGAGGGAGG - Intronic
1087860259 11:103144787-103144809 CTGGAAACACAGATATACGGTGG + Intronic
1088031946 11:105262049-105262071 CTGGAGAGAGGGAGGGAGGGAGG + Intergenic
1088647248 11:111927000-111927022 CTGGAGGCGGAGCTGGAGGGGGG + Intergenic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1088922520 11:114271504-114271526 CTGGAGCCACACATGTAGTGGGG - Intronic
1089083534 11:115797746-115797768 GTGGAGACAAAGCTGGAGGCAGG + Intergenic
1089175804 11:116547972-116547994 AGGGAGGCACAGGTGGAGGGAGG - Intergenic
1089189483 11:116643765-116643787 CTGGCCACACAGAAGGTGGGTGG + Intergenic
1089200037 11:116719051-116719073 CTGGAGAGGCAGATAAAGGGAGG - Intergenic
1089813606 11:121152564-121152586 CTGGAGATTCAGATGGGCGGTGG + Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090458467 11:126869393-126869415 CTGGAGACACTGCAGGAGAGTGG - Intronic
1090653428 11:128825266-128825288 CTGGAGCCACTGGTGGATGGCGG + Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091400443 12:177736-177758 CTGGGGACAGGGATGGAGAGGGG - Exonic
1091654244 12:2333661-2333683 CTGCAGAGAGAGATGGAGGTTGG + Intronic
1091713596 12:2760360-2760382 CTGAGGATAAAGATGGAGGGAGG + Intergenic
1092069265 12:5619519-5619541 CTGGATACACAGCTAGATGGGGG + Intronic
1092231519 12:6778209-6778231 ATGGAGAGAGAGACGGAGGGCGG - Intronic
1092276232 12:7062897-7062919 CAGGAGACACTGAAGAAGGGAGG + Exonic
1092317939 12:7439774-7439796 CTGGACATAAAGATCGAGGGGGG - Intronic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1094281332 12:28743006-28743028 CTGGAGTCACAGAAGCATGGAGG - Intergenic
1095226336 12:39681306-39681328 CTGGGGACTCTGGTGGAGGGTGG + Intronic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1095572456 12:43699111-43699133 GTAGAGAGACAGAGGGAGGGGGG - Intergenic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1096743709 12:53712375-53712397 CAGCAGACGGAGATGGAGGGAGG - Intronic
1096869066 12:54582132-54582154 CTGGGGACACAGAGAAAGGGAGG + Intronic
1096978022 12:55710854-55710876 CAGGGGACAAGGATGGAGGGGGG + Intronic
1097173713 12:57130851-57130873 CTGGAGATACAGAGGGGGCGTGG - Intronic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098285540 12:68903789-68903811 AAGGAGAGACAGAGGGAGGGAGG - Intronic
1099126170 12:78760993-78761015 CAGGAGACAGAGAGAGAGGGAGG + Intergenic
1100449322 12:94690251-94690273 CTGGAGTAATAGATGGAGGCTGG - Intergenic
1100620959 12:96272480-96272502 CTGGAGAAACGGCTGGAGAGTGG + Intergenic
1100787462 12:98093958-98093980 CTGGAGAATCAGTGGGAGGGTGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1101842620 12:108339332-108339354 CCAGAGAAACAGCTGGAGGGAGG + Intronic
1101967508 12:109291529-109291551 CTGGCCAAGCAGATGGAGGGAGG - Intronic
1102409426 12:112704429-112704451 ATGGAGAGACAGAGGGAAGGTGG + Intronic
1102646479 12:114407064-114407086 CTGGAGAAAGGGATGGAGGGAGG + Intronic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1103905447 12:124325258-124325280 CTGGACGGACAGATGGATGGAGG + Exonic
1104271073 12:127282747-127282769 CTGGAGACACACAGCCAGGGAGG + Intergenic
1104382747 12:128322151-128322173 CAAGAGAGACAGATGGAGGCTGG - Intronic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106472643 13:30071297-30071319 GTAGAGAGACAGAGGGAGGGGGG + Intergenic
1106777136 13:33019486-33019508 GTGGAAACACAGAGGGAGTGAGG - Intronic
1107351547 13:39520062-39520084 CTGGGCTCCCAGATGGAGGGTGG - Intronic
1107360334 13:39610865-39610887 AAGGAGACAGAGATGGAGAGAGG + Intergenic
1107931043 13:45307671-45307693 CTGTTGACAGAAATGGAGGGAGG + Intergenic
1108224806 13:48277554-48277576 CTGGAAAGAAAGAAGGAGGGAGG + Intergenic
1108743108 13:53359440-53359462 CTGCAGACACAGATGTACGTGGG + Intergenic
1108956545 13:56165884-56165906 CAGGAGAAAGAGATGGAGTGGGG + Intergenic
1110593808 13:77295449-77295471 CTTGAGACACAGATGGATCCGGG - Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1113049981 13:106200138-106200160 ATGGAGGGACAGAGGGAGGGAGG - Intergenic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1113939963 13:114013611-114013633 AGAGAGAGACAGATGGAGGGGGG - Intronic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114209168 14:20601023-20601045 CTGCAGCCACTGATGAAGGGAGG - Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116912759 14:50488651-50488673 CTGGAAACACAGTTGCAGGGTGG - Intronic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1118931329 14:70244078-70244100 CTGGAGCCATACAAGGAGGGAGG - Intergenic
1118953839 14:70461048-70461070 CTGGAGCCATACAAGGAGGGAGG + Intergenic
1119620747 14:76130279-76130301 CTTGAGAAACTGCTGGAGGGAGG - Intergenic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119846740 14:77836126-77836148 GTGGAGACAGAGAGGGAGAGAGG - Intronic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1120913329 14:89687802-89687824 AAGTAGATACAGATGGAGGGGGG + Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122048583 14:99040208-99040230 CTGCAGACAGGGATGGACGGGGG + Intergenic
1122355091 14:101118162-101118184 CTGGAAGGAGAGATGGAGGGAGG - Intergenic
1122397224 14:101442009-101442031 CAGGAGACGCAGGTGGCGGGGGG - Intergenic
1122855760 14:104559424-104559446 CTGGAGATGGGGATGGAGGGAGG - Intronic
1122915906 14:104858889-104858911 GTGGAGATGGAGATGGAGGGTGG - Intergenic
1122935810 14:104955584-104955606 CTGAAGACAGAGGTGGAGGCAGG - Exonic
1122984794 14:105207119-105207141 CTTGAGCCAGAGTTGGAGGGTGG - Intergenic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1125195291 15:37039020-37039042 CATGTGACACAGATGGAGAGTGG + Intronic
1126293208 15:47105993-47106015 CTGGAGACATAAATAGAGGAAGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127702038 15:61510765-61510787 TCTGACACACAGATGGAGGGAGG - Intergenic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128793581 15:70449759-70449781 GTGGATACAGGGATGGAGGGAGG + Intergenic
1128809347 15:70559378-70559400 CTGGAGACAGAAGGGGAGGGAGG + Intergenic
1129111615 15:73340337-73340359 CTGGAGACACGAATGGATGCTGG + Intronic
1129185689 15:73904854-73904876 CAAAACACACAGATGGAGGGAGG + Intergenic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG + Intronic
1129701214 15:77769589-77769611 CTGGAGGCAAGGATGGAGGCAGG + Intronic
1130535151 15:84779071-84779093 GTAGAGAGACAGAGGGAGGGGGG + Intronic
1130567476 15:85008864-85008886 CTCGAGACACAGGGAGAGGGAGG - Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1132080524 15:98861036-98861058 ACAGAGACATAGATGGAGGGAGG - Intronic
1132299318 15:100766561-100766583 CATGAGACAGAGATGGTGGGGGG + Intergenic
1132299517 15:100767400-100767422 AAGGAGAGAAAGATGGAGGGAGG - Intergenic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132338349 15:101063095-101063117 CGGGAGGCAGAGATGGAGGGAGG - Intronic
1132730956 16:1361849-1361871 CTGGGGACACAGATGGCATGAGG - Intronic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133026230 16:2990064-2990086 CTGGAGAGACAGATGAGGTGAGG - Intergenic
1133200784 16:4203262-4203284 CTGGAGACAGAGAGGGCCGGGGG + Intronic
1133547154 16:6818709-6818731 CTGATGACACAGACTGAGGGTGG - Intronic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1135194772 16:20385571-20385593 TTGGAGACTCAGATGCGGGGAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135856852 16:26019597-26019619 TTGGAAACACACAGGGAGGGCGG + Intronic
1135871301 16:26153256-26153278 CTGGAGATACAGAAAGATGGCGG + Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136234527 16:28905616-28905638 AGGGAGACACAGAGGGCGGGAGG + Intronic
1137565866 16:49532224-49532246 CTGGAGACTCTGACGGTGGGTGG + Intronic
1137725597 16:50654727-50654749 CTGGAGTTAGAGAGGGAGGGAGG + Intergenic
1137930628 16:52584052-52584074 CTGGAGGCACAGGGTGAGGGAGG - Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1138639763 16:58375508-58375530 CTGGGGCCAAAGAAGGAGGGAGG - Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1139947478 16:70651125-70651147 CTGGAGACAGAGACCGATGGGGG + Intronic
1140735697 16:77895982-77896004 TTGGAGAGAAAGATGGAGGTTGG + Intronic
1141388990 16:83648763-83648785 CAGGAGACAGAGATGGGGAGAGG - Intronic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1141979667 16:87542101-87542123 CTGGGGACACAGGTTGGGGGTGG + Intergenic
1142034456 16:87854890-87854912 GTGGAGACACAGGTGAAGGGAGG - Intronic
1143057150 17:4170909-4170931 CGGCAGCCACAGACGGAGGGCGG + Intronic
1143410707 17:6706767-6706789 CTGGACACACACCTGGAGCGTGG + Exonic
1143562160 17:7702671-7702693 CTGGAGACCCCGAGGGAGGCAGG + Intronic
1143667519 17:8373103-8373125 GTGGAGACGGAGATGGAGAGAGG - Intronic
1144274857 17:13656463-13656485 GTGGGGACACAGAGGGAAGGGGG + Intergenic
1144490413 17:15704164-15704186 TTAGAGACAGAGTTGGAGGGAGG + Intronic
1144910554 17:18677805-18677827 TTAGAGACAGAGTTGGAGGGAGG - Intronic
1146370211 17:32261429-32261451 CTGGAGATGGAGGTGGAGGGTGG + Intergenic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146626877 17:34441706-34441728 CTGGATGGACAGATGGATGGAGG + Intergenic
1146636365 17:34508465-34508487 CTGGAGATTCAGATGTGGGGAGG - Intergenic
1146820872 17:35982913-35982935 ATGGAGAGAAAGAGGGAGGGAGG - Intergenic
1147425912 17:40345772-40345794 CTGCACACACAGGTGGAGTGGGG - Intronic
1147495028 17:40907408-40907430 AGGGAGACAGAGAGGGAGGGGGG - Intergenic
1147596692 17:41722615-41722637 CTAGAGAGACAGCTGGAGGCTGG + Intronic
1148109249 17:45135639-45135661 ATGGCGACGCAGATCGAGGGGGG - Intronic
1148561599 17:48609894-48609916 CTAGAGAGGCAGGTGGAGGGAGG - Intronic
1148774951 17:50090033-50090055 CTGGACAGACAGATGTTGGGAGG + Intronic
1150612988 17:66748818-66748840 CCGGAGAGAGAGAGGGAGGGCGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151699952 17:75737706-75737728 CTGGGGACCCTGGTGGAGGGTGG - Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152050730 17:77974032-77974054 CTGGAGAGAGGGAGGGAGGGAGG + Intergenic
1152665421 17:81565899-81565921 CTGGAGGCTGGGATGGAGGGCGG + Intronic
1152896531 17:82914470-82914492 GTGCAGACACAGCTGGAGGCCGG - Intronic
1152914637 17:83027134-83027156 CTGGACAGACACACGGAGGGGGG + Intronic
1152935802 17:83135971-83135993 CTGCAGACAGACATGCAGGGAGG - Intergenic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1154055504 18:11009443-11009465 CTGGAGATTCAGCTGAAGGGAGG + Intronic
1155589257 18:27406892-27406914 CAGAAAACAGAGATGGAGGGAGG + Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1155945150 18:31840364-31840386 ATAGAGAGACAGAGGGAGGGAGG + Intronic
1156012531 18:32511616-32511638 CTGGAGAGACAGCGGGACGGAGG + Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1157475793 18:48022643-48022665 CAGGAGACACTGGTGGAGAGGGG + Intergenic
1157977488 18:52342362-52342384 CGGGAGGGACAGACGGAGGGAGG - Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158725502 18:59968224-59968246 CAAGAGACAGAGATGGAGGCAGG + Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1160211261 18:76882060-76882082 CTAGAAGCACAGAGGGAGGGCGG - Intronic
1160427877 18:78790708-78790730 GTGGACACACAGATGGGGAGCGG + Intergenic
1160851599 19:1195456-1195478 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160852023 19:1197270-1197292 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1161253281 19:3292948-3292970 CTGGAGACACAGATCCTGGCTGG + Intronic
1161256000 19:3310063-3310085 GAGGAGAGAGAGATGGAGGGAGG - Intergenic
1161256020 19:3310141-3310163 ATGGAGACAGGGAGGGAGGGAGG - Intergenic
1161256061 19:3310315-3310337 AGGGAGAGAGAGATGGAGGGAGG - Intergenic
1161256186 19:3311086-3311108 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1161256200 19:3311208-3311230 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161649346 19:5474774-5474796 GGGGAGACACGGAGGGAGGGAGG + Intergenic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161795408 19:6383536-6383558 CTGCAAGCACAGATGCAGGGTGG - Intronic
1162311542 19:9910609-9910631 ATGGAGAGGCAGATGGATGGTGG + Intronic
1162958385 19:14112411-14112433 CTGCAGCCACAGCTGGAAGGTGG + Intronic
1163383676 19:16985828-16985850 ATGGAGAGAGAGATGGAGGGTGG + Intronic
1163640841 19:18461147-18461169 CCGGAGGCGCAGGTGGAGGGCGG + Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164581656 19:29438780-29438802 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165051150 19:33142377-33142399 CTGGAGAAAGTGGTGGAGGGAGG + Intronic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165595477 19:37008784-37008806 CGGGAGACACAGCAAGAGGGAGG - Intronic
1165805417 19:38577873-38577895 GTGTAGACACAGCTGGAGTGTGG - Intronic
1165843262 19:38802158-38802180 CTGGGGACAGAGAGGGATGGGGG + Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166302569 19:41920898-41920920 AGGGAGAGACAGAGGGAGGGGGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166343301 19:42151133-42151155 CTGGGGACCCAGATGGGAGGAGG + Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1166720447 19:44993094-44993116 CTGGAAACACAGAGGGACAGAGG - Exonic
1166871902 19:45876441-45876463 CCAGAGACCCAGGTGGAGGGAGG - Intergenic
1166965229 19:46525879-46525901 CTGGACACACAGATTGAGAGAGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167373258 19:49097289-49097311 CTCGAGACACAGAAAAAGGGAGG - Intronic
1167374337 19:49103066-49103088 CTGCAGACGCAGCTGGTGGGAGG + Intronic
1167634248 19:50644815-50644837 TTGGAGAAATAGATGAAGGGAGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167822498 19:51941371-51941393 TTGGAGACAGACATGGAAGGAGG - Intronic
1168300329 19:55401368-55401390 TTAGAGACAGAGTTGGAGGGAGG + Exonic
1168421077 19:56204155-56204177 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168424367 19:56226765-56226787 CTGGAGGGATAGAGGGAGGGAGG + Intronic
1168426305 19:56241978-56242000 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168527112 19:57098097-57098119 CTGGAGCCGGAGATGCAGGGAGG - Intergenic
1168684166 19:58337929-58337951 CTGGAGACAGAGAGAGAGGGAGG - Intronic
925144334 2:1570779-1570801 CTGGAGACTCAGAGGCGGGGAGG - Intergenic
925190229 2:1876487-1876509 CAGGAGCCCCAGATGGACGGGGG - Intronic
925657892 2:6168940-6168962 CTGGAGAGAGGGAAGGAGGGAGG - Intergenic
925696077 2:6580538-6580560 GTGAAGACAGAGGTGGAGGGTGG - Intergenic
925696091 2:6580729-6580751 GTGAAGACAGAGGTGGAGGGTGG - Intergenic
925837991 2:7964679-7964701 CTGGAGAAGCAGAGGTAGGGCGG - Intergenic
926581695 2:14636568-14636590 CTGGGGCCGCAGCTGGAGGGAGG - Exonic
926889438 2:17626565-17626587 CTGCAGACACAGGGGCAGGGTGG - Intronic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927195366 2:20542844-20542866 CTGGGGGCACAGATGGGAGGTGG + Intergenic
927862891 2:26571126-26571148 CTGGAGACCCAGAGGTAGAGAGG + Intronic
928155855 2:28875809-28875831 CCTGAGAAAGAGATGGAGGGTGG - Intergenic
928738333 2:34319155-34319177 CTGGAGACAGATAAGAAGGGTGG - Intergenic
929054690 2:37865841-37865863 CTGGGGCCCCAGCTGGAGGGAGG + Intergenic
929567522 2:42999197-42999219 TTGGAGACCAAGATAGAGGGAGG + Intergenic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930021644 2:47005213-47005235 CTGGACACAGAGAGGAAGGGAGG + Intronic
930192826 2:48478020-48478042 CTGGAGACAGAGATACAAGGGGG + Intronic
932083927 2:68740517-68740539 AGGGAGACCCAGATGGAGAGAGG - Intronic
932265640 2:70365092-70365114 ATGGAGTCACAGCTGGGGGGTGG + Intergenic
932316140 2:70784629-70784651 GTGGAGTCACAGATGGTGGTTGG - Intronic
932746551 2:74338248-74338270 CTGGGGAGACACATGGATGGGGG + Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934161870 2:89257452-89257474 CGGAAGACACAGAGGAAGGGAGG + Intergenic
934205412 2:89924910-89924932 CGGAAGACACAGAGGAAGGGAGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936381964 2:111994228-111994250 CTGGAGACAGAGAGGAAGAGAGG - Intronic
937376667 2:121341128-121341150 CTAGGGCCACAGAGGGAGGGAGG + Intronic
937773795 2:125752089-125752111 GTGGAGACCCAGATCAAGGGAGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938132817 2:128732063-128732085 CTGGAGACACAGAAAGACAGAGG + Intergenic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
945183958 2:207120974-207120996 GTAGAGACAGGGATGGAGGGTGG - Intronic
945416493 2:209579357-209579379 CTGGGGACACACTTGGATGGAGG + Intronic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946605068 2:221394963-221394985 CTCCACACACAGATGCAGGGAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
947288740 2:228547363-228547385 CTGGAGAAAGAGAGGAAGGGAGG - Intergenic
947315345 2:228851625-228851647 CTGGAGACAGGACTGGAGGGGGG + Intronic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
948046555 2:234950676-234950698 CAGGAGACACAGGTGGACAGAGG - Intergenic
948125344 2:235560936-235560958 CATGAGAAACTGATGGAGGGTGG - Intronic
948906643 2:240982830-240982852 CTGGAGACACTGGGGGTGGGAGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1170603000 20:17855978-17856000 AGGGAGACAGAGAGGGAGGGAGG + Intergenic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171091638 20:22290861-22290883 CTGGAGACCCTGATGGACTGAGG + Intergenic
1171536162 20:25892577-25892599 CTGGAGACAGAAATAGAGGAAGG + Intergenic
1171804936 20:29668581-29668603 CTGGAGACATAAATAGAGGAAGG - Intergenic
1171839123 20:30187847-30187869 CTGGAGACATAAATAGAGGAAGG + Intergenic
1172112609 20:32556173-32556195 ATAGAGACACAGAGGGAGGCAGG - Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173122879 20:40309793-40309815 CTGGACTCTCTGATGGAGGGCGG + Intergenic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1174060813 20:47831630-47831652 CTGGACACACAGACAGAGAGGGG - Intergenic
1174071085 20:47899740-47899762 CTGGACACACAGACAGAGAGGGG + Intergenic
1174175293 20:48640791-48640813 GTGGGCACACAGATGGAAGGAGG + Intronic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1175236564 20:57516985-57517007 CTGGGGAGGCAGATGGAGTGTGG - Intronic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175780460 20:61679191-61679213 GAGGAGACAGAGATGGAAGGTGG - Intronic
1176650649 21:9543903-9543925 CTGGAGTGAAAGGTGGAGGGAGG + Intergenic
1177378921 21:20312538-20312560 CTGGAGACTTAGAAGGTGGGAGG + Intergenic
1179285351 21:39973200-39973222 CAGGGGAGACAGATGCAGGGCGG - Intergenic
1179311085 21:40196689-40196711 CAGGAGACAGAAATAGAGGGAGG - Intronic
1179382839 21:40915320-40915342 CTGCAAACTCACATGGAGGGTGG - Intergenic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179486273 21:41712593-41712615 CTGGAGAGACAAAGGGAGGTGGG - Intergenic
1179544584 21:42105739-42105761 CTAGAGCCCCAGAGGGAGGGCGG + Intronic
1179935884 21:44603058-44603080 GTGGAGACAGAGAAGGAGGCTGG + Intronic
1179951877 21:44712819-44712841 AGAGAGACAGAGATGGAGGGAGG + Intergenic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181041929 22:20196410-20196432 CTGGAGACGCAGGTGCAGGTGGG - Intergenic
1181349491 22:22244923-22244945 CTGGTGACACAGATGCATGTGGG - Intronic
1181364812 22:22367730-22367752 CTGGAGACAGAAGTGGATGGAGG + Intergenic
1181787654 22:25238447-25238469 TTGGAGATACAGCGGGAGGGAGG + Intergenic
1181819390 22:25463485-25463507 TTGGAGATACAGCGGGAGGGAGG + Intergenic
1181893304 22:26083975-26083997 CTAGGGACAGAGATGGAGGCAGG + Intergenic
1182003595 22:26940889-26940911 GTGGGGGCACAGAGGGAGGGAGG + Intergenic
1182398428 22:30054881-30054903 CTGGACAAACAGATGCAGTGTGG + Intergenic
1183262291 22:36803516-36803538 ATGGATGGACAGATGGAGGGAGG + Intronic
1183341917 22:37286298-37286320 AAGGTGACACAGCTGGAGGGTGG - Intronic
1183663331 22:39234003-39234025 CGGGAGCCACGGAGGGAGGGAGG + Intronic
1183677278 22:39306661-39306683 ATGGTGTCACAGATGGATGGGGG + Intergenic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1184812917 22:46849235-46849257 CTGGAGACCCACTTGGACGGAGG - Intronic
950109823 3:10411910-10411932 CTGGAAATGCAGATGGTGGGTGG - Intronic
950157642 3:10735679-10735701 CTGGAGACAGAGACCCAGGGAGG + Intergenic
950157674 3:10735867-10735889 CTGGAGACAGAGACCCAGGGAGG - Intergenic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
950548394 3:13652569-13652591 CTGGAGCCAGAGTTGAAGGGAGG + Intergenic
950674123 3:14544491-14544513 CTGGAGTCAGAGATGAAGGACGG - Intergenic
951059035 3:18183117-18183139 TTGGAGTCCCAGATTGAGGGTGG - Intronic
952195211 3:31068303-31068325 GTGGAGTCACAGAGGGAGGGAGG - Intergenic
952881533 3:37989038-37989060 CCAGAGACACAGAGGGAGGCTGG + Intronic
952962000 3:38598177-38598199 CAGGAAACAAAGATGGAGGTGGG + Intronic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
953461017 3:43081241-43081263 CTGCAGATCCTGATGGAGGGCGG - Exonic
953614837 3:44480584-44480606 CTGCAGAAAAAGATGGAGGGTGG - Intergenic
953793942 3:45968492-45968514 CTGCAGACAGAGAGGGAGAGGGG - Exonic
953830140 3:46289944-46289966 AGAGAGACAGAGATGGAGGGAGG + Intergenic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG + Intergenic
954935916 3:54326878-54326900 TTTGAGTCACAGATAGAGGGAGG + Intronic
955098120 3:55820151-55820173 GTGGAGCCCCACATGGAGGGTGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955569667 3:60291102-60291124 CTGCAGACACACAAGGAGTGAGG + Intronic
955693266 3:61610774-61610796 ATGGAGAGAGAGAGGGAGGGAGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956741538 3:72279833-72279855 CATGAGCCATAGATGGAGGGAGG + Intergenic
956781746 3:72608737-72608759 CTGAAGAGACTGATGGAGAGGGG + Intergenic
958574244 3:95927060-95927082 CTACAGAAACAGAGGGAGGGGGG + Intergenic
958935187 3:100249145-100249167 ATGAGGTCACAGATGGAGGGAGG + Intergenic
958952314 3:100429789-100429811 CTGGGGCCACAGCTGGAGAGAGG + Exonic
960581605 3:119283610-119283632 CAGGAGACAGAGAATGAGGGAGG - Intergenic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
961434372 3:126906463-126906485 CACGAGGCACAGATGCAGGGAGG - Intronic
961465672 3:127079605-127079627 CAGGAGACATAGATGGAGAGTGG + Intergenic
961609311 3:128123929-128123951 CCGGAGACACAGACGGAAGTGGG - Intronic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
962414493 3:135169631-135169653 CTGAAGGCTCTGATGGAGGGAGG + Intronic
962439048 3:135395081-135395103 TGGGGGACACAGAGGGAGGGAGG - Intergenic
962458906 3:135591058-135591080 CTACAGAGACAGAGGGAGGGTGG - Intergenic
963063374 3:141242566-141242588 CTGGAGACAGTGCTGGGGGGTGG + Intronic
963066381 3:141267826-141267848 AGGGAGACAGAGAGGGAGGGAGG - Intronic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
965824325 3:172715603-172715625 CTGGAGCATCAGATGCAGGGAGG + Intergenic
965962449 3:174444270-174444292 GTGGGGGCACAGATGGAGGTGGG + Intronic
966439273 3:179925993-179926015 CAGGAGAAACATTTGGAGGGGGG - Intronic
966839448 3:184076767-184076789 CAGGAGAGAAGGATGGAGGGAGG + Intergenic
967487832 3:190054863-190054885 ATGGAGAACAAGATGGAGGGGGG - Intronic
967766866 3:193290604-193290626 CTGGATACACAGGTGAATGGGGG + Intronic
967923779 3:194631306-194631328 CTGGAGACACCGAGACAGGGTGG + Intronic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968331965 3:197878524-197878546 CTGGTGACGGAGAAGGAGGGAGG - Intronic
968702997 4:2065454-2065476 GGGGAGACAGAGGTGGAGGGTGG + Exonic
968736747 4:2301235-2301257 CTTGAGACACAGATGAGTGGGGG + Intronic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
968949332 4:3682430-3682452 CAGGCGTCACAGATGAAGGGTGG + Intergenic
969109925 4:4838272-4838294 CTGGAGACACAGTTGTGAGGGGG - Intergenic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
970974131 4:22023413-22023435 CTGGGGACACAGGTTGAGGCTGG + Intergenic
971394283 4:26214302-26214324 AAGGAGACAGAGAAGGAGGGAGG + Intronic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971765568 4:30826437-30826459 CTGGAGACTCAGTTGGACCGAGG - Intronic
972336630 4:38112818-38112840 CAGGTCACACAGATGGAGTGTGG - Intronic
974086402 4:57265360-57265382 CAGGAGCCAGAGAGGGAGGGAGG + Intergenic
974837192 4:67265297-67265319 AGGGAGACACAGAAGGTGGGTGG - Intergenic
975528191 4:75373947-75373969 CTGAGGACACAGCTAGAGGGAGG + Intergenic
975762980 4:77636054-77636076 CTGCAGCCACTGATGAAGGGAGG + Intergenic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976816130 4:89149671-89149693 GTGAAGACACACAGGGAGGGTGG + Intergenic
977049303 4:92106888-92106910 CTGGGGGCACAGAGGCAGGGTGG + Intergenic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
979264073 4:118681443-118681465 CTGTAGACACATATGGCCGGTGG + Intergenic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
980378769 4:131982129-131982151 TTGGAGACTCAGATGTGGGGAGG - Intergenic
980410546 4:132413116-132413138 CAGGAGACACAGAGTGAAGGGGG - Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
980992925 4:139753938-139753960 CTGGAGACTGGGGTGGAGGGAGG + Intronic
981572046 4:146162241-146162263 CAGGAGACAGAGAGGGATGGGGG - Intergenic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
982318640 4:154057449-154057471 GTAGAGACACGGAGGGAGGGAGG - Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
985894024 5:2738730-2738752 CCGGAGGCACAGGAGGAGGGAGG - Intergenic
986775023 5:11006423-11006445 CCAGAGCCACAGATGGAAGGAGG + Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987374148 5:17218256-17218278 CAGCAGCCAAAGATGGAGGGTGG + Intronic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988882534 5:35518802-35518824 CTGAAGTTCCAGATGGAGGGAGG - Intergenic
989677177 5:43985496-43985518 CAGGAGCCACAGAGCGAGGGGGG + Intergenic
989810611 5:45668380-45668402 CAGGAGAGAGAGATTGAGGGAGG - Intronic
990908807 5:60833076-60833098 TTGTAGACAAAGATGGAGGGGGG + Intronic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991942513 5:71866136-71866158 CTAGAGACACAGGTCTAGGGAGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992137113 5:73758050-73758072 CTGGGAACACAAGTGGAGGGAGG - Intronic
992409729 5:76493380-76493402 ATGGAGACACACAGGGAAGGAGG - Intronic
994089992 5:95801256-95801278 GTACAGACACAGAGGGAGGGCGG - Intronic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996310283 5:122096606-122096628 CTGCAGAGACAGAGGGATGGGGG - Intergenic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997431647 5:133845012-133845034 GTGGAGACACAGGGGGACGGCGG - Intergenic
998163314 5:139825818-139825840 CTGAAGACAGAGATGGGGTGGGG + Intronic
998504482 5:142660907-142660929 CTGGAGCCAGAGAAGGAAGGAGG - Intronic
999904494 5:156124755-156124777 AGGGAGGGACAGATGGAGGGAGG + Intronic
1000131963 5:158308919-158308941 CTGAAGACATAGAAGAAGGGAGG - Intergenic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1000834317 5:166135422-166135444 CTGGAGGCCCAGATGCTGGGAGG + Intergenic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1002965934 6:1966592-1966614 GTGATGACACAGCTGGAGGGTGG - Intronic
1003013906 6:2452410-2452432 CAGCTGACACAGATGGTGGGAGG + Intergenic
1004319463 6:14621319-14621341 GTGCAGACAGAGAGGGAGGGTGG - Intergenic
1005224018 6:23620247-23620269 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1005624608 6:27651618-27651640 GCGGAGACAGAGAAGGAGGGAGG + Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006443050 6:34063838-34063860 CTGGGGAGACAGATGGACAGAGG + Intronic
1007282105 6:40720388-40720410 CGGGAGGGACAGAGGGAGGGAGG + Intergenic
1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG + Intergenic
1008902701 6:56640340-56640362 CTGGAGTGACAGATGGAGTCAGG + Exonic
1009764938 6:68060166-68060188 CTGGAGACAAACTTGGAGCGAGG + Intergenic
1010189803 6:73183489-73183511 CTGGACACAGAGCTGGATGGCGG - Intronic
1010379989 6:75213357-75213379 CTTGAGAAGCAGATAGAGGGAGG - Intergenic
1010472780 6:76249555-76249577 CAGGAGACACAGAAGACGGGTGG + Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011713467 6:90079214-90079236 CTGTAGACACAGATGTTGGAGGG - Intronic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1013376014 6:109515005-109515027 GTGGGGACACAGATAGAAGGTGG + Intronic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013804478 6:113982267-113982289 CTGGACACAGAGTGGGAGGGTGG - Intronic
1014069661 6:117166891-117166913 CTGGAGACACAGAAGAGAGGTGG - Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014707317 6:124763435-124763457 CAGGAGCAAGAGATGGAGGGAGG + Intronic
1015478435 6:133679675-133679697 ATGAAGACAGAGATGGAAGGAGG + Intergenic
1015673140 6:135713670-135713692 CTGGAGACTCGGAGGGAGAGTGG - Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016264192 6:142212761-142212783 CAGGAGACAGAGAGGGAAGGGGG + Intronic
1017608462 6:156158347-156158369 CTAGAGACAAAGATGGAGGTAGG + Intergenic
1018977433 6:168575976-168575998 CATGAGACACAGAGGCAGGGTGG + Intronic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019417800 7:935292-935314 CTGGAGCCAGAGATGCCGGGCGG - Intronic
1019742485 7:2681779-2681801 TAGGAGACAGGGATGGAGGGAGG + Intronic
1020005579 7:4782335-4782357 CTCCCGACACAGAGGGAGGGAGG - Intronic
1020851926 7:13364380-13364402 ATAAAGACACAGAGGGAGGGGGG - Intergenic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021841640 7:24726032-24726054 CGGCAGGCAGAGATGGAGGGAGG + Intronic
1021870776 7:25004117-25004139 CTGGGAACTCAGATGTAGGGAGG - Intergenic
1022307702 7:29163694-29163716 CTGGTGACAGAGATGGCAGGAGG - Intronic
1023165463 7:37338974-37338996 CTCCAGGCACTGATGGAGGGTGG + Intronic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024118297 7:46213147-46213169 CTGAAGACAGAGTTGGAGAGGGG + Intergenic
1024222556 7:47299863-47299885 CTGGAGACAGGGATGAGGGGAGG + Intronic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1024957037 7:54933266-54933288 CTGGTGGCAGAGAGGGAGGGAGG + Intergenic
1024974318 7:55099503-55099525 ATGCAGTCCCAGATGGAGGGGGG + Intronic
1025287636 7:57679285-57679307 CTGGAGACATAAATAGAGGAAGG + Intergenic
1025789576 7:64676685-64676707 CTGTGGACACATATGGGGGGAGG - Intronic
1026009799 7:66628266-66628288 CGGGACACACAGATGGAGACAGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026937059 7:74263590-74263612 ATGGAGACAGGCATGGAGGGAGG - Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1029504186 7:100952200-100952222 GTGGTCACACAGATGGAGGTGGG - Exonic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1031155111 7:118100825-118100847 TTGGAGACACAAAAGGCGGGAGG - Intergenic
1031356595 7:120794473-120794495 CCGGAGAGAGAGATGGGGGGTGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031882355 7:127211444-127211466 ATGCCCACACAGATGGAGGGTGG + Intronic
1032934280 7:136711176-136711198 GGGGAGAGACAGAGGGAGGGAGG + Intergenic
1033157754 7:138971331-138971353 CTGGGGACAGAGATGTATGGGGG - Intronic
1033536025 7:142312881-142312903 AGGGAGACAAAGATAGAGGGAGG + Intergenic
1033764046 7:144468305-144468327 TTGGAGACAGGGATGGAGAGTGG + Intronic
1033789386 7:144773271-144773293 CTGAAGAAAGGGATGGAGGGAGG + Intronic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034066804 7:148144794-148144816 CTGGAGACACACATTAAGCGAGG + Intronic
1034313404 7:150109969-150109991 CTGGGGACAGTCATGGAGGGAGG + Intergenic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1034406115 7:150903471-150903493 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1034748618 7:153547083-153547105 CTGGTGAGACAGAAGGAAGGAGG - Intergenic
1034793457 7:153990695-153990717 CTGGGGACAGTCATGGAGGGAGG - Intronic
1034955457 7:155331553-155331575 TTGGAGACACAGATGGCTTGGGG + Intergenic
1035078588 7:156198037-156198059 CTGGAGGAACACATGGAGAGAGG - Intergenic
1035132462 7:156668632-156668654 CGGGAGACACGGAGTGAGGGAGG - Intronic
1035255371 7:157622512-157622534 AAAGAGACACAGAGGGAGGGAGG + Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035705086 8:1669253-1669275 CTGGGGGCCCAGATGGACGGCGG - Intronic
1035727599 8:1834409-1834431 CTGGAGACACAGGCCCAGGGAGG + Intronic
1035954901 8:4066224-4066246 CAGGAGACAAAGAAGGAAGGAGG - Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036614906 8:10380720-10380742 CTGGAGAGATGGATGGAAGGAGG + Intronic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037648040 8:20811578-20811600 AGGCAGAGACAGATGGAGGGTGG + Intergenic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1039945647 8:42126766-42126788 TTGGAGACAGAGAAGGAGGGAGG - Intergenic
1041170885 8:55141256-55141278 CTGGAGGCAGAGGAGGAGGGAGG - Intronic
1041307161 8:56473235-56473257 TTGGATGCACAGATGGAGGCCGG + Intergenic
1041343982 8:56876501-56876523 CGTGAGAGACAGAAGGAGGGAGG + Intergenic
1041552179 8:59115665-59115687 CTGGACAGACACATGGAGGCTGG - Intronic
1042171938 8:66000092-66000114 AAGGAGACACAGACAGAGGGAGG - Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044143401 8:88683066-88683088 CTGGAGACACTGAAGTAGGGTGG + Intergenic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1044817856 8:96131324-96131346 TTGGAGACAGAGATGCAGGGAGG - Intergenic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1046199875 8:110911143-110911165 CTGGGGATACAGAGGGCGGGGGG + Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1046859119 8:119070525-119070547 AGGGAGAGAGAGATGGAGGGAGG - Intronic
1047179869 8:122576779-122576801 CTGGATTCAGAGATGGAAGGGGG - Intergenic
1047204297 8:122791049-122791071 CTGGAGCCACAGGTGCATGGAGG - Intronic
1047350828 8:124071972-124071994 TTGGAGACACAGCTTTAGGGAGG - Intronic
1047893787 8:129342995-129343017 ATGGAGACACAGTAGGAAGGAGG + Intergenic
1048037157 8:130688242-130688264 CCTGAGACATAGATGGAGGAAGG + Intergenic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1049014119 8:139907554-139907576 ATGGAGGCAGAGAGGGAGGGAGG + Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049368354 8:142251730-142251752 CTGCAGACAGAGATCGCGGGTGG - Intronic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049441760 8:142612842-142612864 CCGGAAAGACAGACGGAGGGAGG + Exonic
1050120336 9:2301204-2301226 CAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1051638457 9:19202755-19202777 TTGGACAGACAGATGCAGGGGGG - Intergenic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1052728963 9:32262892-32262914 CTTGAGCCTCAGATGGAAGGAGG - Intergenic
1052988875 9:34506922-34506944 CTGGAGCCACTGGAGGAGGGAGG + Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053800394 9:41760440-41760462 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054188823 9:61972592-61972614 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054464493 9:65485352-65485374 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054649698 9:67616025-67616047 CTGGACACGCAGATGCAGAGAGG + Intergenic
1055432639 9:76259433-76259455 GTGTAGACAGAGAGGGAGGGAGG - Intronic
1056702914 9:88925683-88925705 TTTGGGACACAGATGGAGGAAGG - Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058583556 9:106483757-106483779 CTGGAGAATCAGATGCAGGGAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059877585 9:118652667-118652689 AGGGAGACAGAGAGGGAGGGAGG + Intergenic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1061059759 9:128244607-128244629 GAGGAGGCACAGATGGATGGGGG - Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061963340 9:133999038-133999060 GTGGAGGGATAGATGGAGGGAGG - Intergenic
1062161119 9:135080460-135080482 CTGGACACACGGAGGGAGAGGGG + Intronic
1062170358 9:135131621-135131643 CTGGAGTCAGTGATGAAGGGGGG - Intergenic
1062376745 9:136265266-136265288 CTGGGGGCACATGTGGAGGGGGG - Intergenic
1203377016 Un_KI270442v1:384500-384522 AGGGAGAGAAAGATGGAGGGAGG - Intergenic
1203628388 Un_KI270750v1:47456-47478 CTGGAGTGAAAGGTGGAGGGAGG + Intergenic
1185484165 X:469575-469597 CCGCAGACACAGAGGGAAGGCGG - Intergenic
1185499479 X:585722-585744 CCGGAGACAGGGATGGAGGAGGG - Intergenic
1185889562 X:3812407-3812429 CTGCAGAGAGAGAGGGAGGGAGG - Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1190911527 X:54776060-54776082 CTGGGGGCAGAGTTGGAGGGTGG - Intronic
1190919690 X:54840148-54840170 CTGGGGGCAGAGGTGGAGGGTGG + Intergenic
1191008159 X:55733124-55733146 CTGGAGACACAGAAACGGGGAGG - Intronic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193144140 X:78059970-78059992 CTGGAGAAATACCTGGAGGGAGG - Intergenic
1193508671 X:82372862-82372884 CTGCAATCACAGGTGGAGGGAGG + Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194823843 X:98537534-98537556 GTGCAGACCCAGATTGAGGGTGG - Intergenic
1195091615 X:101464876-101464898 TTGGAATCACAGATGGAGTGCGG + Intronic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1197067618 X:122252624-122252646 GTGGCCACCCAGATGGAGGGCGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199296480 X:146164641-146164663 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1199341271 X:146680061-146680083 CTGGATACAGGGAGGGAGGGTGG - Intergenic
1199922982 X:152429286-152429308 CTGGAGAAAGAGAGGGAGGGAGG - Intronic
1200100141 X:153686097-153686119 CTGGAGACAGAAGTGAAGGGTGG - Intronic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic
1202048069 Y:20753994-20754016 GTACAGACACAGAGGGAGGGAGG + Intergenic