ID: 1059742409

View in Genome Browser
Species Human (GRCh38)
Location 9:117164814-117164836
Sequence CAGGTGTTCAGGAGGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059742402_1059742409 7 Left 1059742402 9:117164784-117164806 CCCATCCCTCACTGGGCATCTGA 0: 1
1: 0
2: 0
3: 16
4: 218
Right 1059742409 9:117164814-117164836 CAGGTGTTCAGGAGGACAAATGG No data
1059742403_1059742409 6 Left 1059742403 9:117164785-117164807 CCATCCCTCACTGGGCATCTGAT 0: 1
1: 0
2: 0
3: 28
4: 286
Right 1059742409 9:117164814-117164836 CAGGTGTTCAGGAGGACAAATGG No data
1059742401_1059742409 11 Left 1059742401 9:117164780-117164802 CCTACCCATCCCTCACTGGGCAT 0: 1
1: 0
2: 3
3: 32
4: 266
Right 1059742409 9:117164814-117164836 CAGGTGTTCAGGAGGACAAATGG No data
1059742404_1059742409 2 Left 1059742404 9:117164789-117164811 CCCTCACTGGGCATCTGATTCTC 0: 1
1: 0
2: 2
3: 39
4: 309
Right 1059742409 9:117164814-117164836 CAGGTGTTCAGGAGGACAAATGG No data
1059742405_1059742409 1 Left 1059742405 9:117164790-117164812 CCTCACTGGGCATCTGATTCTCA 0: 1
1: 0
2: 0
3: 27
4: 297
Right 1059742409 9:117164814-117164836 CAGGTGTTCAGGAGGACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059742409 Original CRISPR CAGGTGTTCAGGAGGACAAA TGG Intronic
No off target data available for this crispr