ID: 1059743365

View in Genome Browser
Species Human (GRCh38)
Location 9:117177216-117177238
Sequence AGACACTCCTTGGCCTATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059743365 Original CRISPR AGACACTCCTTGGCCTATAC AGG (reversed) Intronic
900165608 1:1243232-1243254 AGCCACTCCTGGGCCTGTCCTGG - Intronic
903285437 1:22273933-22273955 AGACACTCCTGGGCACATAGTGG + Intergenic
906314889 1:44780130-44780152 AGTCACTCCGTTGCCTAGACTGG + Intergenic
908177794 1:61572881-61572903 AGACACTCCCAGGCCCATGCAGG - Intergenic
908253358 1:62282758-62282780 AGACAGGCCTTGCCCTATCCAGG + Intronic
915353549 1:155241596-155241618 AGACAGTCTTTGCCCTATAGAGG + Intronic
920775523 1:208932910-208932932 AGAAACTCCTTGTCCTACACAGG - Intergenic
923356543 1:233161490-233161512 ACACACTCATTGGCACATACTGG + Intronic
924898898 1:248373377-248373399 AGACACTCCTTGGGCCAAAAGGG - Intergenic
1066957624 10:42188088-42188110 AGACAGCTCTTGTCCTATACTGG + Intergenic
1067097159 10:43309271-43309293 ACACACTCCTTGACCAAAACAGG - Intergenic
1069375437 10:67788368-67788390 AGAAACACCTGGGCCTATAAAGG - Intergenic
1070566884 10:77610346-77610368 AGACAGTCCTTGGCACATAGAGG + Intronic
1076079415 10:127565294-127565316 AGTGACTGCTTGGCCTACACTGG - Intergenic
1078466840 11:11556315-11556337 ACACACCCTTTGCCCTATACCGG + Intronic
1079893804 11:26093191-26093213 ACACACTACTGGGCATATACTGG - Intergenic
1084672238 11:70614147-70614169 TGACACTCCTTGGCCTTCCCTGG - Intronic
1088442842 11:109890631-109890653 AGATACACCTGGGACTATACAGG - Intergenic
1092977856 12:13763229-13763251 GGACAGTACTTGGCCTATCCTGG - Intronic
1099247666 12:80213553-80213575 AGACAACCCTTTGCCTATTCTGG - Intronic
1100595965 12:96072406-96072428 AGAATCTCCTTGGCCTAGCCTGG - Intergenic
1103904173 12:124319052-124319074 AGACACTCCTGGGCCCCCACAGG + Intergenic
1104753879 12:131256881-131256903 AGACACTCCTTGACTTATGATGG + Intergenic
1107167940 13:37305120-37305142 AGACACCCCATGGCCCATAATGG + Intergenic
1112492662 13:99881126-99881148 AGACACTCCATGGCCTTTGATGG - Intronic
1118619663 14:67603024-67603046 AGAAACTTCTTAGCCTGTACAGG - Intergenic
1118661602 14:68019691-68019713 AGTCATCCCTTGGCATATACTGG - Intronic
1124085676 15:26548667-26548689 AGGCTCTCCTTGCCCAATACTGG + Intronic
1137463744 16:48689349-48689371 AGACACTCCTGGGACTCTAGTGG - Intergenic
1140853128 16:78953232-78953254 AGATTCTCCTTGGTCTATATAGG + Intronic
1140991228 16:80213531-80213553 AGACACACCTTTGCCTATGGGGG + Intergenic
1153617871 18:6951256-6951278 AGCCACTGGTTGGCCTCTACAGG - Intronic
1157034010 18:43949383-43949405 AGACACTCACAGGCCTTTACAGG - Intergenic
1158353277 18:56587337-56587359 AGATGCTCCTTGACCTATAAAGG - Intergenic
1161077660 19:2294219-2294241 ACACACACCTAGCCCTATACAGG + Intronic
1163292718 19:16391023-16391045 AGACACTCCTTGACTTATGATGG + Intronic
926945449 2:18182755-18182777 AGACACTGCCTGGCCTACATAGG + Intronic
931213273 2:60217622-60217644 AGACTCTCCTTGGTCTTTTCAGG - Intergenic
932116013 2:69048101-69048123 AGACTCTCCTTGGAGTATCCAGG - Intronic
932347334 2:71004268-71004290 GGACACTCCATGGCCTACTCAGG - Intergenic
934305742 2:91820602-91820624 AGACAGCTCTTGTCCTATACTGG + Intergenic
934327514 2:92032140-92032162 AGACAGCTCTTGTCCTATACTGG - Intergenic
934465903 2:94262719-94262741 AGACAGCTCTTGTCCTATACTGG - Intergenic
935143016 2:100371295-100371317 AGATGCTCCTTGGCTTATAATGG + Intergenic
935519737 2:104090009-104090031 ACAGACACCTTGGCCTATATGGG + Intergenic
939821854 2:146967287-146967309 AGGCACTTCTTGGCTGATACTGG + Intergenic
942982089 2:182094926-182094948 AGATACTCCTTGGCTTACAATGG - Intronic
943598297 2:189883801-189883823 AGACATTCCTTGCCCTCTAGAGG + Intronic
944601765 2:201310250-201310272 AGATACTCCTTGGTATATTCAGG - Intronic
945195914 2:207237644-207237666 AGACACAATCTGGCCTATACAGG + Intergenic
946342971 2:219083919-219083941 ATACACTCCTTGACCTATGATGG + Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173869309 20:46331690-46331712 GGACACTCCTTGGGCTGGACTGG + Intergenic
1176596900 21:8705914-8705936 AGACAGCTCTTGTCCTATACTGG - Intergenic
1176673557 21:9756151-9756173 AGATACTCCTTGACCTACAATGG - Intergenic
1180279822 22:10683356-10683378 AGACAGCTCTTGTCCTATACTGG - Intergenic
1180587038 22:16901892-16901914 AGACAGCTCTTGTCCTATACTGG - Intergenic
1184060170 22:42076832-42076854 TGACCCTCCTGGGCCTCTACTGG - Intronic
951411302 3:22371177-22371199 TGCCACTCGTTGGCCTATGCTGG - Intronic
953333520 3:42074125-42074147 AGACACTGCTTGCCCTATGATGG - Intronic
954139700 3:48598595-48598617 AGACACCCCTTGGCCCCTTCTGG + Intergenic
958485499 3:94702281-94702303 AGACAGTCCTTGGGATACACTGG + Intergenic
973771321 4:54209700-54209722 AGACAGTGCTTGGCATATACTGG - Intronic
974834287 4:67228560-67228582 AGGCATTCTTTGGCCTAAACAGG + Intergenic
978135980 4:105260478-105260500 AGACAGTCCCTGACCTATAATGG - Intronic
984346434 4:178533381-178533403 AGACACTCAGTGGCCTATTATGG + Intergenic
984416918 4:179473067-179473089 AGATATTCCTTGGCCTCTACAGG - Intergenic
988842483 5:35096580-35096602 AGACACTCCTTGGACTGTAATGG - Intronic
990419442 5:55617164-55617186 AGACACTGCCTGGCATTTACAGG + Intergenic
991526271 5:67562052-67562074 AGACAGTCCCTGACCTATAGTGG + Intergenic
992825997 5:80550753-80550775 AAACACTCCTTGCCCCAGACGGG - Intergenic
1006827439 6:36946471-36946493 AGACCCTCCCCGACCTATACTGG + Intergenic
1007821741 6:44565343-44565365 GGCCACACCCTGGCCTATACTGG + Intergenic
1011096343 6:83668852-83668874 AGACACTCCTTGACTTATTGTGG + Intronic
1012486282 6:99725477-99725499 AGACACACCTTGGGCTAGAAGGG - Intergenic
1013752038 6:113418004-113418026 AGACAATCCTCTGCCTTTACAGG + Intergenic
1015368217 6:132421601-132421623 AGACCATCCTTGCCCTGTACTGG + Intergenic
1016605069 6:145911438-145911460 AGAAACCCCTTGTCCTATTCGGG + Intronic
1016677975 6:146793764-146793786 AGACACTGCCTGGCATTTACAGG - Intronic
1023236032 7:38088626-38088648 AGGCACTCCTTGTTCTATATTGG - Intergenic
1030825002 7:114144219-114144241 AGATACTCCTTGACCTACAATGG - Intronic
1035623165 8:1050555-1050577 AGGCGCTCCTTGGCTTATAATGG - Intergenic
1038589692 8:28825211-28825233 AGAAACTCCTTGGCTCCTACCGG - Intronic
1039276480 8:35938415-35938437 AGACACTGCTTGGCATTTACAGG + Intergenic
1042732511 8:71952768-71952790 AGGCACTCCTTGCTCTAGACAGG + Intronic
1043574843 8:81645445-81645467 AGAAACTCCTTGGCCCAGCCTGG + Intergenic
1046172858 8:110534368-110534390 ACACAATCATTGGCATATACAGG + Intergenic
1053695957 9:40639496-40639518 AGACAGCTCTTGTCCTATACTGG - Intergenic
1053942942 9:43270534-43270556 AGACAGCTCTTGTCCTATACTGG - Intergenic
1054307204 9:63438714-63438736 AGACAGCTCTTGTCCTATACTGG - Intergenic
1054405937 9:64762706-64762728 AGACAGCTCTTGTCCTATACTGG - Intergenic
1054439563 9:65248193-65248215 AGACAGCTCTTGTCCTATACTGG - Intergenic
1054490844 9:65773746-65773768 AGACAGCTCTTGTCCTATACTGG + Intergenic
1055835614 9:80437571-80437593 ATATACTCCATGACCTATACTGG - Intergenic
1056443959 9:86646570-86646592 AAACACACCTAGGCCTACACAGG - Intergenic
1058386772 9:104445405-104445427 AAACACCCATTGGCCTATTCTGG + Intergenic
1059743365 9:117177216-117177238 AGACACTCCTTGGCCTATACAGG - Intronic
1059751907 9:117255596-117255618 AGACTCTCCTTCACCTCTACAGG - Intronic
1202778404 9_KI270717v1_random:13109-13131 AGACAGCTCTTGTCCTATACTGG - Intergenic
1185653272 X:1664632-1664654 AGATACTCCTTGACCTAAAATGG - Intergenic
1187240620 X:17509720-17509742 AGACAATCCAGGGCCTATACTGG + Intronic
1195244836 X:102986206-102986228 AAATATTCCTAGGCCTATACTGG + Intergenic
1196126850 X:112110151-112110173 AGACACTGCCTGGCATTTACAGG - Intergenic
1201193718 Y:11471412-11471434 AGACAGCTCTTGTCCTATACTGG - Intergenic
1201531263 Y:14991751-14991773 AGACACTGCCTGGCATTTACAGG + Intergenic