ID: 1059749375

View in Genome Browser
Species Human (GRCh38)
Location 9:117233371-117233393
Sequence CTTGACTGATGAGGAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1148
Summary {0: 1, 1: 0, 2: 4, 3: 72, 4: 1071}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059749375_1059749382 19 Left 1059749375 9:117233371-117233393 CCTGATTTTCCTCATCAGTCAAG 0: 1
1: 0
2: 4
3: 72
4: 1071
Right 1059749382 9:117233413-117233435 TCCCTGACTCCCAGGGTGGTTGG No data
1059749375_1059749379 12 Left 1059749375 9:117233371-117233393 CCTGATTTTCCTCATCAGTCAAG 0: 1
1: 0
2: 4
3: 72
4: 1071
Right 1059749379 9:117233406-117233428 TTTACCTTCCCTGACTCCCAGGG No data
1059749375_1059749380 15 Left 1059749375 9:117233371-117233393 CCTGATTTTCCTCATCAGTCAAG 0: 1
1: 0
2: 4
3: 72
4: 1071
Right 1059749380 9:117233409-117233431 ACCTTCCCTGACTCCCAGGGTGG No data
1059749375_1059749378 11 Left 1059749375 9:117233371-117233393 CCTGATTTTCCTCATCAGTCAAG 0: 1
1: 0
2: 4
3: 72
4: 1071
Right 1059749378 9:117233405-117233427 ATTTACCTTCCCTGACTCCCAGG No data
1059749375_1059749384 20 Left 1059749375 9:117233371-117233393 CCTGATTTTCCTCATCAGTCAAG 0: 1
1: 0
2: 4
3: 72
4: 1071
Right 1059749384 9:117233414-117233436 CCCTGACTCCCAGGGTGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059749375 Original CRISPR CTTGACTGATGAGGAAAATC AGG (reversed) Intronic
900041289 1:467019-467041 TTCAACTGATGAGGAAAATGAGG + Intergenic
900062723 1:701994-702016 TTCAACTGATGAGGAAAATGAGG + Intergenic
900207788 1:1438995-1439017 CCTGGCTGATGGGGAAGATCTGG - Intronic
901337837 1:8466421-8466443 CTTCACAGATGAGGAAACTGAGG + Intronic
901402452 1:9024220-9024242 CATAACTGATGAGGAAATTAAGG - Intronic
901646197 1:10718066-10718088 TTTGACAGATGAGGAAACTGAGG + Intronic
901656011 1:10769930-10769952 CTTGACAGATGGGGAAACTGAGG + Intronic
901917788 1:12513148-12513170 CTTGCCTGATGTGAGAAATCAGG - Intergenic
902189243 1:14749830-14749852 CTTGACAAATGAGGAAACTGAGG - Intronic
902195924 1:14798017-14798039 CTTTACAGATGAGGAAACTGAGG + Intronic
902206301 1:14870634-14870656 TTTAACAGATGAGGAAAACCGGG - Intronic
902217710 1:14945097-14945119 CTTGACAGATGGGGAAACTAAGG - Intronic
902293715 1:15451761-15451783 CTTTACAGATGAGGAAACTGAGG + Intergenic
902381350 1:16053918-16053940 TTTTACTGATGAGGAAACTGAGG - Intronic
902560236 1:17272824-17272846 TGTGACAGATGAGGAAAATGAGG - Intronic
902560421 1:17273872-17273894 TTTTACTGATGAGGAAACTGAGG - Intronic
902745568 1:18471516-18471538 CTTGACAGATAAGGAAACTGAGG + Intergenic
902819468 1:18935151-18935173 TTTGACTAATGAGGAAACTAAGG - Intronic
902835127 1:19042221-19042243 TTTCACAGATGAGGAAAATGGGG - Intergenic
903023357 1:20410057-20410079 CTTTACAGATGAGGAAACTGAGG - Intergenic
903053249 1:20617291-20617313 TTTTACTGATGAGGAAACTGAGG - Intronic
903210246 1:21814270-21814292 TTTTACCGATGAGGAAAATGAGG + Intronic
903259476 1:22123610-22123632 TTTGACAGATGAGGAAACTGAGG + Intronic
903282648 1:22258710-22258732 CTTGATGGATGAGGAAAGTGGGG + Intergenic
903306704 1:22417991-22418013 CTTTACAGATGAGGAAACTGAGG - Intergenic
903586921 1:24423098-24423120 CTTGACTTCAGAGGAAATTCAGG + Intronic
903694220 1:25195568-25195590 TTTGACAGATGAGGAAACTGAGG + Intergenic
903749280 1:25610563-25610585 TTTCACAGATGAGGAAACTCAGG + Intergenic
903814969 1:26058247-26058269 TTTGACAGATGAGGAAACTGAGG + Intronic
903925584 1:26828375-26828397 TTTTACTGATGAGGAAACTGGGG - Intronic
904016170 1:27422707-27422729 CTTTACAGATGAGGAAACTAAGG - Intronic
904261513 1:29290342-29290364 CTTTACTGATGAGGAAACTGAGG + Intronic
904292925 1:29499238-29499260 CTTTACTGATGAGGAAACTGAGG - Intergenic
904342142 1:29843499-29843521 CTTTGCTGATGAGGAAACTGAGG + Intergenic
904378301 1:30095345-30095367 CTTTACAGATGAGGAAACTGAGG + Intergenic
904379781 1:30102920-30102942 CTTTACAGATGAGGAGAATGAGG + Intergenic
904412340 1:30332024-30332046 CTTTACTGATGAGGAAACGGAGG + Intergenic
904448892 1:30598458-30598480 CTTTACAGATGAGGAAACTGAGG - Intergenic
904829219 1:33295896-33295918 TTTGACAGATGAGGAAACTGAGG - Intronic
904915977 1:33970927-33970949 TTTTACTGATGAGGAAACTGAGG - Intronic
904945235 1:34194291-34194313 CTTGACAGATGAGGAATACAAGG + Intronic
905224460 1:36469969-36469991 CTTTACAGATGAGGAAACTGAGG - Intronic
905721454 1:40206278-40206300 TTTTATTGATGAGGAAAGTCAGG + Intronic
905879604 1:41454968-41454990 CTTGATGGATGAGGAAACTGAGG - Intergenic
906024652 1:42663319-42663341 CTTGATAGATGAGGAAATTGAGG + Intronic
906069144 1:43004990-43005012 TTTGACAGATGAGGAAATTGAGG - Intergenic
906169471 1:43712109-43712131 TTTCACTGATGAGGAAACTTAGG - Intronic
906184713 1:43852799-43852821 CTTGACTAATGAGTGAAATAAGG - Intronic
906196991 1:43935764-43935786 CTTGACTGGTGAGGGAGAGCAGG + Intronic
906208616 1:44000091-44000113 CTTTACAGATGAGGAAACTGAGG - Intronic
906502864 1:46354519-46354541 CTAGACAGATTAGGTAAATCAGG - Intronic
906638143 1:47424156-47424178 CTTTATAGATGATGAAAATCAGG + Intergenic
906696112 1:47824493-47824515 CTTCACAGATGAGGAAACTGAGG + Intronic
906699484 1:47847514-47847536 CTGGACTGATGGGGAAACTGAGG + Intronic
906918979 1:50042945-50042967 TTTTACTGGTGAGGAAAGTCAGG - Intergenic
907051692 1:51333998-51334020 TTTTACTGATGAGGAAACTGAGG - Intronic
907172441 1:52481290-52481312 CTTTATAGATGAGGAAAATGAGG + Intronic
907215120 1:52856515-52856537 TTTTACAGATGAGGAAAATGAGG + Intronic
907331029 1:53671782-53671804 TTTTACAGATGAGGAAATTCAGG + Intronic
907341143 1:53737356-53737378 CTTGACAGATGGGGAAACTGAGG + Intergenic
907456157 1:54576913-54576935 TTTGACAGATGAGGAAACTAAGG + Intronic
907514643 1:54985952-54985974 CTTCACAGATGAGGAAACTGAGG + Intronic
907614164 1:55907022-55907044 TTTTACAGATGAGGAAAATGAGG - Intergenic
907754303 1:57295530-57295552 TTTTACTGATGAGGAAACTGAGG - Intronic
907908074 1:58802893-58802915 ATTGACAGATGAGGAAACTAAGG + Intergenic
907980546 1:59476357-59476379 TTTTACTGATGAGGAAATTAAGG + Intronic
908021085 1:59899719-59899741 CTTTAGTGATGAGGAAACTGAGG - Intronic
908031537 1:60005208-60005230 TTTGACAGATGAGGAAACTGAGG + Intronic
908253247 1:62281885-62281907 CTTGGCAGATGAGGAAACTGAGG + Intronic
908404474 1:63800767-63800789 CTGCTCTGATGAGAAAAATCTGG + Intronic
909029273 1:70520568-70520590 TTTTACTGATGAGGAAACTGTGG + Intergenic
910089743 1:83448285-83448307 CTTTACAGATGAGGACACTCTGG + Intergenic
910142674 1:84043478-84043500 CTTTACTGATGAGGGAAATGAGG + Intergenic
910982193 1:92969793-92969815 CTCCACAGAAGAGGAAAATCAGG + Intergenic
911043196 1:93608058-93608080 AAGGACTGATGAGTAAAATCTGG - Intronic
911406623 1:97448372-97448394 TTTAACTGATGAGGAAACTGAGG - Intronic
911473447 1:98347059-98347081 TTTTACTGATGAAGAAACTCAGG - Intergenic
911662243 1:100514668-100514690 CTTTACAGATGAGGAAACTGAGG - Intronic
911738682 1:101364003-101364025 CTGGCCTAATGAGAAAAATCAGG - Intergenic
911782346 1:101898273-101898295 TTTGACTGATCAGGAAACTGTGG + Intronic
912213150 1:107577229-107577251 CTTTACATATGAGAAAAATCTGG + Intronic
913077402 1:115352707-115352729 CTTTACTGACAAGGAAAATGGGG - Intergenic
913197243 1:116467543-116467565 TTTCACGGATGAGGAAAGTCAGG - Intergenic
913216410 1:116624383-116624405 CTTTACAGATGAGGAAACTGAGG - Intronic
913359881 1:117968610-117968632 CTTTACAGATGAGGAAAACAAGG + Intronic
913381766 1:118218663-118218685 CTTTACAGATGAGGAAACTGAGG - Intergenic
913515699 1:119603788-119603810 CTTTACTGGTGAGGAAACTGAGG - Intergenic
915161576 1:153923982-153924004 CTTTACAAATGAGGAAAATTAGG + Intergenic
915303841 1:154966705-154966727 TTTTACAGATGAGGAAAATGAGG + Intronic
915611748 1:156999237-156999259 CTTTACGGATAAGGAAAATGAGG + Intronic
915834355 1:159163325-159163347 TTTTACAGATGAGGAAAATGAGG - Intergenic
915941534 1:160121345-160121367 CTTTACAGATGAGGAAACTGAGG + Intronic
916579734 1:166096600-166096622 CTTTACAGATGAGGAAACTGAGG - Intronic
916785768 1:168085999-168086021 CTTTACAGATGAGGAAACTGAGG - Intronic
917016557 1:170538153-170538175 CTTGATAGATGAGGAAACTAAGG + Intronic
917018356 1:170559964-170559986 CTTGACACATGGGGAAAATAAGG - Intergenic
917623861 1:176826034-176826056 TTTTACTGATGAGGAAACTGAGG + Intronic
917834082 1:178927099-178927121 TTTTACTGATGAGGAAATTGAGG - Intergenic
918016622 1:180640112-180640134 TTTTACTGATGAGGAAACCCAGG + Intronic
919255730 1:195121532-195121554 CATAGCTGATGAAGAAAATCAGG + Intergenic
919681726 1:200442228-200442250 TTTGACAGATGAAGTAAATCAGG + Intergenic
919964195 1:202504819-202504841 CTTTACAGATGAGGAAACTGAGG - Intronic
919998250 1:202774180-202774202 GTTGAGTGATGAGGATCATCAGG - Intronic
920270947 1:204763381-204763403 TTTTACTGATGAGGAAACTGAGG + Intergenic
920692107 1:208154986-208155008 CCAGACTGAGGAGGAAAATTGGG + Intronic
920715025 1:208332161-208332183 CTTTAAAGATGAGGAAACTCAGG + Intergenic
920880544 1:209876414-209876436 CTTGACAGATGAGGAAAATGAGG - Intergenic
921064150 1:211610913-211610935 CTTTACTGATGAGGAAGTTGAGG + Intergenic
921064723 1:211614621-211614643 CTTTACTGATGAGGAAACTGAGG + Intergenic
921097369 1:211898598-211898620 GTTGACAGATGAGGAAACTGAGG - Intergenic
921268068 1:213442547-213442569 CTTTACAGATGAGGAAACTAAGG - Intergenic
921956526 1:220990589-220990611 TTTAACTGCTGAGGAAACTCAGG + Intergenic
922276235 1:224081449-224081471 TTTTACAGATGAGAAAAATCAGG - Intergenic
922449740 1:225727150-225727172 TTTTACAGATGAGGAAAATCAGG + Intergenic
923177724 1:231483908-231483930 TTTTACTCATGAGGAAAATAAGG - Intergenic
923198884 1:231693067-231693089 CTTTACTGATGGGGAAACTGAGG + Intronic
923249306 1:232165279-232165301 CATTCCTGATGAGGAGAATCTGG - Intergenic
923404945 1:233650667-233650689 TTTGACAGATGAGGAAACTAAGG + Intronic
923618305 1:235556209-235556231 CTTTACAGATGAGGAAACTGAGG + Intronic
923640425 1:235753742-235753764 TTTGACAGATAAGGAAAATGAGG - Intronic
924191138 1:241553851-241553873 AATGACTGAAGAGGAAATTCTGG - Intronic
924368373 1:243320657-243320679 TTTTACAGATGAGGAAAAACTGG - Intronic
924474364 1:244370247-244370269 TTTTACTGATGAGGAAACTGAGG + Intronic
924480371 1:244426164-244426186 CATGACTGATTTGCAAAATCAGG - Intronic
924581796 1:245330203-245330225 CTGGCCTGAGGAGGAAATTCAGG + Intronic
924947931 1:248858398-248858420 GTTCACTGATGAGGAAACTGAGG - Intronic
1063174326 10:3538065-3538087 CATGACAGATGAGGAAACTGAGG + Intergenic
1063478784 10:6351982-6352004 CTTGACTAATGGAGAAGATCAGG + Intergenic
1064589484 10:16873881-16873903 TTTCACTGATGAGGAAACTGAGG - Intronic
1065298038 10:24295320-24295342 CTTGTCAGATGAGGAAAAGATGG + Intronic
1065417804 10:25508039-25508061 CTTGACTGATATGGGAATTCAGG - Intronic
1065974055 10:30827186-30827208 CTTTACAGATGAGGAAACTGAGG - Intronic
1066306795 10:34152924-34152946 CTTTACTGATGAGGAAACTGAGG + Intronic
1066306936 10:34154516-34154538 CCTTGTTGATGAGGAAAATCAGG - Intronic
1066509976 10:36084441-36084463 CTTGGAGGATGAAGAAAATCAGG - Intergenic
1067655702 10:48189743-48189765 CTTGACTGATGAATAGGATCTGG - Intronic
1067683178 10:48452738-48452760 CTTTACAGATGAGGAAACTGAGG - Intronic
1068618446 10:59148913-59148935 TTTAACTAATGAGGAAACTCTGG - Intergenic
1068625054 10:59235396-59235418 TTTCACTGATGATGAAAATCTGG + Intronic
1068709958 10:60123069-60123091 TTTGACAGATGAGGAAAATGAGG + Intronic
1068886520 10:62103691-62103713 CTTCACAGATGAGGAAATTGGGG + Intergenic
1069571806 10:69498731-69498753 CTTTACAGATGAGGAAATTGAGG + Intronic
1069743928 10:70702975-70702997 CTTTACTGATGAGGAAAATGAGG - Intronic
1069847179 10:71380397-71380419 CTTTACAGATGAGAAAAATAAGG - Intergenic
1069864466 10:71493056-71493078 CTTAACAGATGAGGAAACTATGG - Intronic
1069888405 10:71638155-71638177 CTTCACAGATGAGGAAATTGAGG + Intronic
1069970706 10:72165999-72166021 CTTTACAGATGAGGAAACTGAGG + Intronic
1070391723 10:75976728-75976750 TTTTACTGATGAGGAAACTGAGG + Intronic
1070440979 10:76443012-76443034 TTTAACTGATGAGGAAACTGAGG + Intronic
1070641141 10:78170942-78170964 TTTTACTGATGAGGAAACTGAGG - Intergenic
1070982596 10:80661515-80661537 CTTTACAGATGAGGAAACTGAGG + Intergenic
1070988315 10:80707794-80707816 CTTTACAGATGAGGAAATTGAGG - Intergenic
1071093831 10:81950398-81950420 CTTTACAGATGAGGAAAGTCAGG + Intronic
1071500807 10:86203044-86203066 TTTTACAGATGAGGAAAATGAGG - Intronic
1071507864 10:86243514-86243536 CTTAACAGATGAGGAAACTGAGG + Intronic
1071572800 10:86707319-86707341 CTTAACAGATGAGGAAACTGAGG - Intronic
1071613533 10:87053928-87053950 TTTTACTGATGAGGAAACTAAGG + Intronic
1071711642 10:88055621-88055643 TTTGACTAATGAGGAAACTGAGG + Intergenic
1072088663 10:92105508-92105530 CTTGAAGGATGAGGAGAATGTGG - Intronic
1072118209 10:92383722-92383744 CTTTACTGATGGGGAAATTGAGG - Intergenic
1072241852 10:93504004-93504026 TTTTACTGATGTGGAAACTCAGG - Intronic
1072537446 10:96374300-96374322 CTTTACAGGTGAGGAAAATGAGG + Intronic
1072725628 10:97811543-97811565 CTTGACAGATGAGGAAACTGGGG - Intergenic
1072793585 10:98337283-98337305 TTTTACAGATGAGGAAAATTAGG + Intergenic
1073126957 10:101156974-101156996 TTTTACTGATGAGGAAACTGAGG - Intergenic
1073175992 10:101558114-101558136 CTTGGCAGATGAGGAAACTGAGG + Intergenic
1073490312 10:103848974-103848996 TTTTACTGATGAGGAAACTGAGG + Intronic
1074049773 10:109871255-109871277 CATGACAGATGAGGAAACTGAGG + Intronic
1074487517 10:113900439-113900461 CTCTACTTATGAGGAAATTCAGG - Intronic
1074505355 10:114065249-114065271 TTTTACTGATGAGGAAACTGAGG + Intergenic
1074583343 10:114742600-114742622 TTTGACTGATGAGAAAACTGCGG - Intergenic
1074774080 10:116753616-116753638 ATTCACAGATGAGGAAAATAAGG - Intergenic
1074930611 10:118121850-118121872 ATTTACTGATGAGGAGAATGAGG + Intergenic
1075083939 10:119401575-119401597 CTTGACAGATGAGGAAACTGAGG - Intronic
1075191441 10:120313095-120313117 TTTTACTAATGAGGAAATTCAGG + Intergenic
1075524332 10:123170081-123170103 TTTTACAGATGAGGAAAATAAGG - Exonic
1075770295 10:124928867-124928889 CAAGAATGATGTGGAAAATCTGG + Intergenic
1076075608 10:127531544-127531566 CTTTACAGATGAGGAAACTGAGG + Intergenic
1078239400 11:9516508-9516530 CTTTACATATGAGGAAAAACAGG - Intronic
1078362723 11:10681607-10681629 GTTCACAGATGAGGAAAATGAGG + Intronic
1078413408 11:11146408-11146430 ATTGACAGATGAGGAAACTAAGG - Intergenic
1078536700 11:12180662-12180684 CTTTACAGATGAGGAAACTGAGG + Intronic
1078563456 11:12393318-12393340 CTTTACAGATGAGGAAACTGAGG + Intronic
1078571312 11:12460346-12460368 TTTTACAGATGAGGAAAATGAGG - Intronic
1078723575 11:13906612-13906634 CTTTACAGATGAGGAAACTGAGG + Intergenic
1079401578 11:20110485-20110507 CTTAACAGATGAGGAAACTGAGG + Intronic
1079581735 11:22073162-22073184 CATGACTGATTAAGAAAATGTGG - Intergenic
1079582221 11:22079757-22079779 TCTGAATGAAGAGGAAAATCAGG + Intergenic
1079615915 11:22492758-22492780 ATTTACTGATGAGGAAACTGAGG - Intergenic
1079631107 11:22676535-22676557 CTGTACAGATGAGGAAAATGAGG - Intronic
1079997531 11:27310497-27310519 CTTTACAGATGAGGAAACTGAGG - Intergenic
1080011831 11:27467651-27467673 ATTTACAGATGAGGAAAATAAGG + Intronic
1080046491 11:27814016-27814038 CTTGACAGATAAGGAATCTCTGG + Intergenic
1080072751 11:28109174-28109196 ATTTCCTGTTGAGGAAAATCGGG + Intronic
1080358685 11:31486318-31486340 CTTTACTGATGAAGAAACTAAGG - Intronic
1080408058 11:31997436-31997458 CTTCACGGATGAGGAAACTAAGG + Intronic
1080452077 11:32385965-32385987 CTTTACAGATGAGGAAATTGAGG - Intergenic
1080646348 11:34190985-34191007 TTTTACTGATGAGGAAACTGAGG + Intronic
1080704948 11:34681727-34681749 ATTGACTATTTAGGAAAATCTGG + Intergenic
1080727015 11:34908533-34908555 CTTGACTGATGAGGAGGAGGAGG - Intronic
1081226277 11:40526783-40526805 CTTTACTGTTGATGAAAATTTGG - Intronic
1081300678 11:41447222-41447244 GTTTACAGATGAGGAAAATGAGG - Intronic
1081304346 11:41492860-41492882 TTTTACAGATGAGGAAAATTAGG - Intergenic
1081396683 11:42594314-42594336 CTTGACAGATAAGGAAACTGAGG - Intergenic
1081547515 11:44082057-44082079 TTTTACAGATGAGGAAAATGAGG + Intronic
1081579795 11:44344458-44344480 TTTTCCTGATGAGGAAAATGAGG - Intergenic
1081691628 11:45082241-45082263 CTTTACAGATGAGGAAACTGAGG + Intergenic
1081809607 11:45907554-45907576 CGTCACAGATGAGGAAACTCCGG - Intergenic
1081962514 11:47148801-47148823 CTTCACAGATGAGGAAACTGAGG + Intronic
1081986459 11:47308175-47308197 TTTGACAGATAAGGAAAATGAGG + Intronic
1082840161 11:57682724-57682746 ATTTTCTGATGATGAAAATCAGG + Intronic
1082926054 11:58548745-58548767 TTTTACTGATGAGGAAAGTAAGG + Intronic
1083403264 11:62439401-62439423 CTTTACAGATGAGAAAAATAGGG - Intronic
1083583130 11:63838060-63838082 CTTTACTGATGGGGAAAATGAGG + Intergenic
1083666580 11:64278557-64278579 GTTTACAGATGAGGAAACTCAGG + Intronic
1083889256 11:65587834-65587856 CTTTACAGATGAGGAAACTGAGG - Intronic
1083980938 11:66168602-66168624 TTTTACAGATGAGGAAAATGAGG - Intronic
1084033551 11:66494686-66494708 CTTCACAGATGAGGAAACTGAGG - Intronic
1084064847 11:66698059-66698081 CTTGACTCTTGAGGAACAGCTGG + Intronic
1084289727 11:68154261-68154283 ATTCACTCATGAGGATAATCTGG - Intergenic
1084418807 11:69049881-69049903 CTTCACAGATGAGGAAACTGAGG + Intronic
1084460998 11:69296479-69296501 CTTAACAGATGAGGAAACTGAGG + Exonic
1084469934 11:69353642-69353664 CTTCACAGATGAGGAAACTGAGG - Intronic
1084481404 11:69422834-69422856 CTTGACTGGTGGGGAAATGCGGG - Intergenic
1084573503 11:69974462-69974484 CTTTACAGATGAGGAAACTGAGG + Intergenic
1084584687 11:70050824-70050846 TTTGACAGATGAGGAAATTGAGG - Intergenic
1085173230 11:74466213-74466235 TCTTACTGATGAGGAAAATGAGG - Intronic
1085323555 11:75589539-75589561 CTTGTCTGATGAAGAAAATGAGG + Intronic
1085405371 11:76258606-76258628 CTTTACAGATGAGGAAACTGAGG + Intergenic
1085718747 11:78895417-78895439 TTTGATTGATGAGGAAACTGAGG + Intronic
1085907271 11:80778752-80778774 TTTCACTGATGAGGAAATTGAGG - Intergenic
1086955673 11:92932545-92932567 TTTGACAGATGAGGAAACTGAGG - Intergenic
1087130562 11:94666196-94666218 CTTTACTGATGAGGAAACTCAGG + Intergenic
1088139062 11:106593697-106593719 CTTGAGTGATGAGCAAAAGAAGG - Intergenic
1088590713 11:111400176-111400198 CTTTACAGATGAGGAAACTGAGG - Intronic
1088808502 11:113373116-113373138 CTTTACAGATGAGGAAACTGAGG + Intronic
1089002652 11:115064903-115064925 CTTTACAGATGAGGAAACTGGGG + Intergenic
1089308559 11:117542776-117542798 CTTTACAGATGAGGAAATTATGG + Intronic
1089744163 11:120605407-120605429 TTTAACTGATGAGGAAAATGAGG - Intronic
1089973707 11:122714641-122714663 TTTTACTGATGAGGAAACTGAGG - Intronic
1090240105 11:125175756-125175778 GTTGACTGATGGGGAAAGTGAGG - Intronic
1090255269 11:125279441-125279463 CATGTCAGATGAGGAAAATGAGG + Intronic
1090268890 11:125371764-125371786 CATTACTGATAAGGAAAAGCTGG + Intronic
1090615787 11:128513347-128513369 TTTGACTGATGAAGAAAATGAGG + Intronic
1090908797 11:131100219-131100241 CTTGATTGATGAAGAAACTAAGG - Intergenic
1091166442 11:133480290-133480312 TTTGACAGATGAGGAAACTGTGG + Intronic
1091809629 12:3385235-3385257 TTTTACTGATGAGGAAATTGAGG + Intronic
1091970609 12:4783491-4783513 CTTTCCTGATGAGGAAACTAAGG + Intronic
1092746916 12:11681408-11681430 ATGGAATGATGTGGAAAATCAGG + Intronic
1092936652 12:13370090-13370112 GTTGAGTGATGAGGCAAATTAGG + Intergenic
1093157757 12:15708249-15708271 CTTTACAGATGAGGAAAGTGAGG - Intronic
1093589678 12:20886491-20886513 CATGAGTTATGAGGAAAATTGGG + Intronic
1093886248 12:24464746-24464768 CTTTCCAGATGAGGAAACTCAGG + Intergenic
1094284209 12:28774162-28774184 CTTTACAGATGAGGAAACTGAGG + Intergenic
1094587873 12:31794551-31794573 TTTTACAGATGAGGAAAATGAGG + Intergenic
1095158810 12:38891390-38891412 CTTTACTGAATAGCAAAATCAGG + Intronic
1095159287 12:38897912-38897934 CTTTACAGATGAGGAAACTGAGG + Intronic
1095222936 12:39639654-39639676 CTTTACTGATGAGGAAACTAAGG - Intronic
1095393596 12:41738510-41738532 CTCGACTGCTGAGTAAGATCAGG - Intergenic
1095694236 12:45126255-45126277 CCTGGGTGATGAAGAAAATCAGG - Intergenic
1095799795 12:46259933-46259955 CATGCCTGATTAGGAAATTCTGG + Intronic
1095976756 12:47945467-47945489 TTTTACTGATGAGGAAACTGAGG - Intergenic
1096105539 12:48995272-48995294 TTTGACAGATGAGGAAACTGAGG + Exonic
1097008218 12:55933988-55934010 CTTTACTGATGAGAAAACTGAGG + Intronic
1097396274 12:59078832-59078854 ATTCACTGATAAGGAAAATGAGG + Intergenic
1098016734 12:66112871-66112893 CTTAACAGATGAGGAAACTGAGG - Intergenic
1098051411 12:66457865-66457887 TTTGACGTATGAGGAAATTCAGG - Intronic
1098236803 12:68425288-68425310 CTTTACAGATGAGGAAACTAAGG + Intergenic
1099426066 12:82524000-82524022 TTTTACAGATGAGGAAAATATGG - Intergenic
1099932323 12:89088676-89088698 TTAAACTGATGAGGAAAATGGGG + Intergenic
1100229721 12:92594714-92594736 CTTTACAGATGAGGAAACTGAGG + Intergenic
1100287980 12:93185575-93185597 CTTTACAGATGAGGAAACTGAGG + Intergenic
1100863691 12:98833213-98833235 CTTGACAGATGAAGAAACTGTGG + Intronic
1101117992 12:101550711-101550733 TTTGACAGATGAGGAAACTGAGG - Intergenic
1101119801 12:101566954-101566976 TTTTACGGATGAGGAAATTCAGG - Intergenic
1101244250 12:102870381-102870403 TTTTACTGATGAGGAAACTAAGG - Intronic
1101312565 12:103596453-103596475 TTTGACAGATGAGGAGAATAAGG - Intronic
1101436301 12:104667685-104667707 CTTTACCGATGAGGAAACTGAGG - Intronic
1101446404 12:104739786-104739808 CTTTACTGATGAGGAGACTGAGG + Intronic
1101655540 12:106716838-106716860 CTTTACAGATGAGAAAACTCAGG + Intronic
1101803010 12:108038919-108038941 TTTTACAGATGAGGAAAATGAGG + Intergenic
1101816426 12:108149536-108149558 CTTGACAGATGAGGAAGCTGAGG + Intronic
1101933999 12:109041061-109041083 GTTGACTGATGAGGAAACAGAGG - Intronic
1102011162 12:109619401-109619423 CTTGACAGATGAGGAAATGGAGG + Intergenic
1102066815 12:109983888-109983910 CTTTACTGATAAGGAAACTAGGG + Intronic
1102180975 12:110911992-110912014 CTTTACAGATGAGGAAATTGAGG + Intronic
1102257900 12:111426788-111426810 TTTGACAGATGAGGAAACTGAGG + Intronic
1102405001 12:112665484-112665506 CTTTACAGATGAGGAAACTGAGG - Intronic
1102600450 12:114025800-114025822 TTTCACAGATGAGGAAAATAGGG + Intergenic
1102717829 12:114989406-114989428 CTTTACAGATGAGGAAACTGAGG - Intergenic
1102778351 12:115540946-115540968 ATTTACTGATGAGGAAACTGTGG + Intergenic
1102793262 12:115665937-115665959 TTTGACAGATGAGGAAACTGAGG - Intergenic
1102871824 12:116419796-116419818 CTTCTCTGATGAGGAAAAAGAGG - Intergenic
1102872920 12:116427902-116427924 CTTGACAGTTGAGGAAACTGAGG + Intergenic
1102915751 12:116750516-116750538 CTAGACAGATGAGGAAACTGAGG - Intronic
1102915772 12:116750680-116750702 CTTGATAGATGAGGAAACTGAGG - Intronic
1103324812 12:120113395-120113417 CTTGACAGATGAGTAAATTGAGG - Intronic
1103510537 12:121470602-121470624 CTTGACAGATGAGGAGACTGAGG + Intronic
1103715364 12:122942075-122942097 TTTTACTGATGAGGAATCTCAGG + Intronic
1103862857 12:124028130-124028152 CTTTACAGATGAGGAAACTGAGG - Intronic
1103965563 12:124637328-124637350 CTTTACAGATGAGGAAAAAGAGG + Intergenic
1103985286 12:124762960-124762982 CTTTACTGATGAGGAAGTTGAGG + Intergenic
1104444192 12:128820611-128820633 TTTTACTGATGAGGAAACTGAGG - Intronic
1105674370 13:22654528-22654550 TTTGACTGACAGGGAAAATCGGG - Intergenic
1107064648 13:36200107-36200129 CTTGACAGATGAGAAAACTGAGG - Intronic
1107123225 13:36818201-36818223 CTTTACTGATGAGGAAACTGAGG + Intergenic
1107176912 13:37409856-37409878 TTTGACAGATGAGGAAATTGGGG - Intergenic
1107188055 13:37547159-37547181 CTTGCCCCATGAGGAAAAGCAGG + Intergenic
1107268944 13:38591717-38591739 CTTCACAGATGAGGAAAGTGAGG + Intergenic
1107285204 13:38782661-38782683 CTTTGCAGATGAGGAAACTCAGG - Intronic
1107698004 13:43019541-43019563 CTTTACTAATGAGGAAACTGAGG + Intergenic
1107725960 13:43299493-43299515 CTTTACAGATGAGAAAAATGTGG + Intronic
1108576172 13:51793400-51793422 CTTGATTAATGGGGAAACTCAGG - Intronic
1110074118 13:71217050-71217072 CATGACAGATGAGGAAAGTGAGG - Intergenic
1110098155 13:71558226-71558248 GTTGACTGATGAGGTAAATCAGG + Intronic
1110111620 13:71754518-71754540 TTTTACAGATGAGGAAAATGAGG + Intronic
1110327520 13:74234409-74234431 CTTTACAGATGATGAAAATATGG - Intergenic
1110921229 13:81088633-81088655 CTTGAAAGGTGAGGAAAATAAGG - Intergenic
1111866510 13:93775334-93775356 CTTTACAGATGAGGAAACTGAGG + Intronic
1111962167 13:94823679-94823701 CTTTATTGATGAAGAAAAACTGG - Intergenic
1112228921 13:97568488-97568510 CTTTACTGATATGGAAAATGAGG - Intergenic
1112384306 13:98923885-98923907 TTTAACAGATGAGGAAAATCAGG + Intronic
1113543462 13:111127031-111127053 GTGGACTGATTAGGAAAAACGGG + Intronic
1114481334 14:23036810-23036832 CTTGGATGATGTGGAAAATGCGG + Intergenic
1114633863 14:24176633-24176655 CTTTACCGATGAGGAAAGTGAGG + Intronic
1114777748 14:25504496-25504518 ATTTACTGATGAGGAAACTGAGG - Intergenic
1115378972 14:32711869-32711891 CTTTACAGATGAAGAAAATGAGG - Intronic
1115528878 14:34307698-34307720 CTTTACAGATGAAGAAAATGAGG - Intronic
1115623045 14:35159740-35159762 CTTGACAAATGAGGAAACTGAGG + Intronic
1115687451 14:35810860-35810882 GTTTACAAATGAGGAAAATCAGG - Intergenic
1115877231 14:37874535-37874557 TTTGACTGATGAGGAAATCAAGG + Intronic
1115896334 14:38092495-38092517 CTGGAGAGATGAGGAAAACCTGG + Intergenic
1116655127 14:47642949-47642971 GTTGACATATGAGGAAAATTAGG - Intronic
1117030045 14:51659195-51659217 CTTTACTGATGAGGAAAAAGAGG - Intronic
1117268470 14:54115707-54115729 CTTTACTGATGAGGAAGCTGAGG - Intergenic
1117325046 14:54661110-54661132 CTTGACAGATAAGGAAATTGAGG - Intronic
1117343789 14:54813533-54813555 ATTGACAGATGAGGAAACTAAGG + Intergenic
1117372389 14:55090443-55090465 TTTGCCTGATGTGGAAAAACTGG - Intergenic
1118229758 14:63936980-63937002 CTTGATGAAGGAGGAAAATCAGG + Intronic
1118255149 14:64199381-64199403 CTTGACAGATGAGGAAACCGAGG - Intronic
1118311240 14:64694766-64694788 CTTGACTGATGGGGAGGATTTGG - Intergenic
1118612326 14:67551473-67551495 TTTTACTGATGAGGAAACTGAGG + Intronic
1118634929 14:67739588-67739610 CTTGGCAGATGAGGAAATTGAGG - Intronic
1118675118 14:68175839-68175861 CTTTACTGATGAGGAAATGGAGG - Intronic
1118805206 14:69230217-69230239 CTTTACAGATGAGGAAACTGAGG - Intronic
1118810236 14:69267787-69267809 CCTGACAGATGAGGAAACTAAGG - Intronic
1118847232 14:69556763-69556785 CTTTACAGATGAGGAAAATGAGG + Intergenic
1118894429 14:69934061-69934083 CTTAACAGATGAGGAAACTGAGG + Intronic
1119443370 14:74644562-74644584 CTTTACTGATGGGGAAACTGAGG - Intergenic
1119567327 14:75639852-75639874 CTTTACAGATGAGGAAATTGAGG - Intronic
1119602139 14:75983203-75983225 CTTTACGGATGAGGAAACTGAGG + Intronic
1119618575 14:76114566-76114588 CTTTACAGATGAGGAAACTGAGG - Intergenic
1121458049 14:94051711-94051733 CTTTACAGATGAGGCAACTCAGG + Intronic
1121720204 14:96103977-96103999 TTTTACTGATGAGGAAACTGAGG - Intergenic
1121723750 14:96130935-96130957 TTTTACAGATGAGGAAACTCAGG + Intergenic
1121918100 14:97854655-97854677 ATTTACTGATGAGGACACTCTGG + Intergenic
1121984670 14:98493147-98493169 CTTTACAGATGAGGAAACTGAGG + Intergenic
1122262232 14:100530162-100530184 CTTTACAGATGAGGAAACTGAGG - Exonic
1122313841 14:100814072-100814094 CTTTACAGATGAGGAAACTGAGG - Intergenic
1122588787 14:102830326-102830348 TTTTACAGATGAGGAAAATGAGG + Intronic
1122740123 14:103867445-103867467 CTTGACAGATGAGGAAACCAAGG + Intergenic
1122744639 14:103890542-103890564 TTTGACAGATGAGGAAACTGAGG + Intergenic
1124576761 15:30916281-30916303 TTTGACAGATGAGGAAACTGAGG - Intronic
1124880222 15:33635312-33635334 TTTTACTGATGAAGAAATTCAGG - Intronic
1125409532 15:39391018-39391040 TTTCACAGGTGAGGAAAATCAGG + Intergenic
1126122471 15:45265980-45266002 CTTTACTGATAAGGAAACTGAGG - Intronic
1126785969 15:52178252-52178274 TTTGACAGATGAGGAAACTGAGG - Intronic
1126888798 15:53181747-53181769 CTTTGCTGATGAGGAAACTGAGG + Intergenic
1127668262 15:61170086-61170108 CTTGACAAATGAGGAAACTGGGG - Intronic
1127695260 15:61440753-61440775 TTTTACAGATGAGGAAAATAAGG + Intergenic
1127861208 15:62995712-62995734 CTTAACAGATGAGGAAACTGAGG - Intergenic
1128440383 15:67702187-67702209 TTTAACAGATGAGGAAAATGAGG - Intronic
1128664487 15:69528212-69528234 CTTTACAGATGAGGAAACTGAGG + Intergenic
1128732428 15:70030325-70030347 CTTCACAGATGAAGAAACTCAGG + Intergenic
1128802041 15:70503012-70503034 TTTAACAGATGAGGAAAATAAGG + Intergenic
1128875205 15:71195889-71195911 CTTGACCAATGAGGAAACTAAGG + Intronic
1129490254 15:75918251-75918273 TTTTACTGATGAGGAAAAAAAGG + Intronic
1129674662 15:77625995-77626017 CTTCACTGATGAGGAAACTGAGG + Intronic
1129717158 15:77859282-77859304 CTTGACAGGTGGGGAAAATGGGG + Intergenic
1129895570 15:79103201-79103223 TTTTACTGATGAGGAAAAGATGG + Intergenic
1129908919 15:79209907-79209929 CTTGCGTGATGGGGAAAACCTGG + Intergenic
1130103335 15:80910714-80910736 CTTGACTGAGCAGGAAACTGAGG - Intronic
1130149873 15:81303391-81303413 CTTTACAGATGAGGAAACTGAGG + Intronic
1130335086 15:82951739-82951761 CTTTACAGATGAGGAAACTGAGG - Intronic
1130393441 15:83479850-83479872 TTTTACAGATGAGGAAACTCAGG - Intronic
1130461870 15:84165015-84165037 CTTGACAGGTGGGGAAAATGGGG - Intergenic
1130576695 15:85099227-85099249 CTTTACAGATGAGGAAACTGAGG + Intronic
1130715327 15:86328551-86328573 CTTAACTCAAGAGGAAAAACAGG + Intronic
1130760547 15:86814824-86814846 CTTTACAGAGGAGGAAAATGAGG - Intronic
1130806197 15:87326133-87326155 TTTGACTGATAAGGAAACTGAGG + Intergenic
1130910738 15:88269270-88269292 TTTTACAGATGAGGAAAATGAGG - Intergenic
1130960248 15:88654221-88654243 CTTGACAGATGAGGAAACTGAGG - Intronic
1130979861 15:88804822-88804844 GTTGACTGATGTGTAAATTCTGG + Intronic
1131514312 15:93066941-93066963 TTTCACTGATGAGGAAACACAGG - Intronic
1132408647 15:101560679-101560701 CTTTACAGATGAGGAAATTAAGG + Intergenic
1133106757 16:3516113-3516135 TTTTACAGATGAGGAAAATGAGG - Intronic
1133210743 16:4262161-4262183 CTTGACCGATGGGGAAACTGAGG + Intronic
1133337909 16:5018089-5018111 CTTTACAGATGAGGAAACTGAGG - Exonic
1133342495 16:5045690-5045712 TTTTACAGATGAGGAAAATGAGG + Intronic
1133440123 16:5814513-5814535 ATTCACAGATGAGGAAATTCAGG + Intergenic
1133771023 16:8867318-8867340 TTTGACAGATGAGGAAACTCGGG - Intronic
1133840803 16:9407549-9407571 CTTTACAGATGAGGAAACTGAGG - Intergenic
1133858540 16:9572786-9572808 CTTTACTGATGAGAAAGAACAGG - Intergenic
1133908511 16:10043205-10043227 CTTTACAGATGAGGAAACTGAGG + Intronic
1134106508 16:11489210-11489232 TTTCACTGATGAGGAAACTGAGG - Intronic
1134358736 16:13509898-13509920 CTTCACAGATGAGGAAAATGAGG - Intergenic
1134387258 16:13785051-13785073 CTTTACTAATGAGGAAATTGGGG + Intergenic
1134440219 16:14295060-14295082 TTTGACAGATGAGGAAACTGAGG - Intergenic
1134471464 16:14530074-14530096 CTTACCTGATGAGCAGAATCAGG - Intronic
1134816427 16:17209672-17209694 TTTGACAGATGAGGAAACTGAGG - Intronic
1134864879 16:17597075-17597097 CTTGACAGATGAGGACACTGAGG + Intergenic
1134890633 16:17838638-17838660 TTTTACAGATGAGGAAACTCTGG + Intergenic
1135065771 16:19308546-19308568 CTTTGCTGATGAGGAAAACGAGG + Intronic
1135152561 16:20021808-20021830 CTTGACTGATTTGTAGAATCGGG + Intergenic
1135182546 16:20288320-20288342 CTTTACGGATGAGGAAACTGAGG + Intergenic
1135235173 16:20748459-20748481 TTTTACTGATGAGGAACATGAGG - Intronic
1135707007 16:24683725-24683747 CTTTACAGATGAGGAAACTGAGG - Intergenic
1135964524 16:27024765-27024787 CTTTACAGATGAGGAAACTGAGG - Intergenic
1136449593 16:30346135-30346157 CTTTGCTGATGAGAAAAATGAGG - Intergenic
1136566327 16:31072967-31072989 TTTTACTGATGAGGAAACTGAGG - Intronic
1137521217 16:49196898-49196920 TTTGACAGATGAGGAAACTGAGG - Intergenic
1137644859 16:50065245-50065267 CTTCACTGATGAGGAAACTAAGG + Intergenic
1137671311 16:50281249-50281271 GTTTACTGATGAGGAAACTGAGG + Intronic
1137795387 16:51213107-51213129 CTTGACAGATGAGGAAACTGAGG + Intergenic
1138301827 16:55936952-55936974 CTTGACAGATGAGGAAACTGAGG + Intronic
1138338493 16:56271261-56271283 CTTTACAGATGAGGAAACTGAGG - Intronic
1138643364 16:58404305-58404327 CTTCACAGATGAGGAAATTGAGG + Intronic
1139213809 16:65107861-65107883 CTTTACAGATGAGGAAACTGAGG + Intronic
1139375561 16:66494371-66494393 CTTTACAGATGAGGAAAACGAGG - Intronic
1139612888 16:68071546-68071568 TTCGACTGATGAGTCAAATCAGG - Intronic
1139669276 16:68480907-68480929 TTTTACTGATGAGGAAACTGAGG - Intergenic
1139761889 16:69190825-69190847 CTTTACAGATGAGGAAACTAAGG - Intronic
1139964130 16:70736180-70736202 CTTTACAGATGAGGAAACTGAGG - Intronic
1140505334 16:75468298-75468320 CTTGAATTAAGAGGAAAATATGG - Intergenic
1140751592 16:78029115-78029137 TTTTACAGATGAGGAAAATGAGG + Intronic
1140946512 16:79773159-79773181 CTTAACAGATGAGGAAAGTGAGG + Intergenic
1141107711 16:81247249-81247271 TTTTACTGATGAGGAAACTGAGG - Intronic
1141144524 16:81519645-81519667 CTTTACAGATGAGGAAACTGAGG - Intronic
1141164923 16:81653937-81653959 CTTCACAGATGAGGAAATTGAGG + Intronic
1141480753 16:84305081-84305103 CTTTACTGATGAGGAAACTGAGG - Intronic
1141530589 16:84643794-84643816 CTTTACAGATGAGGAAACTGAGG - Intergenic
1141740566 16:85889304-85889326 CTTGACAGATGGGGAAACTGAGG - Intergenic
1141764152 16:86047593-86047615 CTTTGCAGATGAGGAAAATGGGG + Intergenic
1141923309 16:87150850-87150872 CTTTACTAATGAGGAAACTGAGG + Intronic
1141991589 16:87614013-87614035 CTTTACAGATGAGGAAACTGAGG + Intronic
1142000221 16:87660097-87660119 CTTTACAGATGAGGAAACTGAGG - Intronic
1142117483 16:88367319-88367341 CTTTACAGATGAGGAAATTAAGG + Intergenic
1142954822 17:3514493-3514515 TTTGACAGATGGGGAAAGTCAGG + Intronic
1143916642 17:10298621-10298643 TTTGACCAATGAGGAAACTCAGG + Intronic
1143934505 17:10468736-10468758 GTTTACTGATGAGGAAACTAAGG + Intronic
1144786566 17:17835598-17835620 CTTGGTTGATGAGGAAACTGAGG - Intronic
1144846630 17:18223474-18223496 TTTTACTGATGAGGAAACTGAGG + Intergenic
1145302826 17:21653094-21653116 TTTTACTGATGAGTAAAATGAGG + Intergenic
1145347479 17:22050097-22050119 TTTTACTGATGAGTAAAATGAGG - Intergenic
1145795845 17:27654969-27654991 CTTTACAGATGAGGAAACTGAGG + Intergenic
1145810300 17:27760293-27760315 CTTTACAGATGAGGAAACTGAGG + Intronic
1146220640 17:31016180-31016202 TTTTACTGATGAGGAAACTAAGG - Intergenic
1146270193 17:31480048-31480070 TTTGACTGAGGAGGAAACTGAGG + Intronic
1146407279 17:32549756-32549778 TGTGACAGATGAGGAAAATGAGG - Intronic
1146931520 17:36781399-36781421 TTTGACAGATGAGGAAACTGAGG - Intergenic
1147021345 17:37536397-37536419 CTTCACAGATGAGGAAACTGAGG - Intronic
1147028931 17:37614723-37614745 GTTTACAGATGAGGAAAATGAGG + Intronic
1147333167 17:39710742-39710764 TTTTACTGATGAGGAAACTGAGG - Intronic
1147377456 17:40031335-40031357 CTTTCAGGATGAGGAAAATCTGG + Intronic
1147948708 17:44095198-44095220 TTTTACTGATGAGGAAACTGAGG + Intronic
1148238053 17:45982617-45982639 CTTTACAGATGAGGAAACTGAGG + Intronic
1148317143 17:46711809-46711831 CTTGACCAATGAGGAGACTCTGG + Intronic
1148343952 17:46890970-46890992 CTTGACAGTTGAGGAAACTGAGG + Intergenic
1148488864 17:48010402-48010424 TTTTACTGATGAGGAAACTGAGG + Intergenic
1148590435 17:48812496-48812518 CTTTACAGATGAGGAAACTAAGG - Intronic
1148905380 17:50908691-50908713 TTTCACAGATGAGGAAACTCAGG + Intergenic
1148911919 17:50947390-50947412 TTTGACAGATGAGGAAACTGAGG + Intergenic
1149452391 17:56759884-56759906 CTTTGCTGATGAGGAAACTGAGG - Intergenic
1149650311 17:58272388-58272410 TTTTACTGATGAGGAAACTGAGG - Intronic
1150127934 17:62650615-62650637 CTTGACAGATGAGGAAACTGAGG - Intronic
1150162894 17:62914374-62914396 CTTGCCAGATAAGGAGAATCTGG - Intergenic
1150224728 17:63518004-63518026 TTTTACTGATGAGGAAACTGAGG + Intronic
1150305823 17:64084508-64084530 CCTTACTGATGAGGAAATTGAGG - Intronic
1150315598 17:64166308-64166330 CTTGAAGGATGAGGAAACTGAGG + Intronic
1151086379 17:71385881-71385903 TTTTACAGATGAGGAAAATGAGG - Intergenic
1151180512 17:72324136-72324158 CTTTACAGATGAGGAAACTGAGG - Intergenic
1151197108 17:72439429-72439451 TTTGACAGATGAGGAAACTGAGG - Intergenic
1151295652 17:73184354-73184376 CTTCACTGAGGAGGAAACTGGGG - Intergenic
1151360311 17:73584711-73584733 TTTGACAGTTGAGGAAACTCAGG - Intronic
1151581741 17:74982949-74982971 CTTCCGTGAGGAGGAAAATCAGG - Intergenic
1152071388 17:78135407-78135429 CTTGAGGGATGAGGAAACTGAGG + Intronic
1152491246 17:80636127-80636149 CTTTACAGATGAGGAAACTGAGG - Intronic
1152602799 17:81273414-81273436 GTTGACAGATGAGGAAACTGAGG - Intronic
1153289543 18:3486795-3486817 CTTGTCTGAACAGGAAAACCAGG + Intergenic
1153303177 18:3609577-3609599 CTCAACAGATGAGGAAACTCAGG - Intronic
1153555205 18:6305321-6305343 TTTAACAGATGAGAAAAATCAGG - Intronic
1153595348 18:6719797-6719819 TTTTACAGATGAGAAAAATCAGG + Intergenic
1153601110 18:6782049-6782071 CTTGACTGATGAATCAGATCTGG - Intronic
1153695932 18:7641870-7641892 CTTTACAGATGAGGAAACTGAGG + Intronic
1153873412 18:9342247-9342269 CTTTACAGATGAGGAAATTGAGG - Intronic
1154036447 18:10806744-10806766 ATTTACAGATGAGGAAAATGAGG - Intronic
1154300213 18:13185590-13185612 TTTCACTGATGAGGAAACTGAGG - Intergenic
1155506515 18:26538760-26538782 TTTGACTGAGGAGGAAACTGAGG + Intronic
1156284741 18:35680723-35680745 TTTTATTGATGAGGAAAATGAGG + Intronic
1156995472 18:43461204-43461226 TGGGACTGATGAGTAAAATCAGG - Intergenic
1157087744 18:44598992-44599014 CTTTGTTGATGAGGAAAATTGGG - Intergenic
1157101228 18:44731779-44731801 TTTGATAGATGAGGAAAGTCAGG - Intronic
1157366719 18:47071679-47071701 CTAGACAGAAGAGGAAACTCAGG + Intronic
1157485739 18:48085547-48085569 CTTGACAGAGGAGGAAACTGAGG - Intronic
1157576359 18:48746453-48746475 CTTGATGGATGGGGAAGATCAGG + Intronic
1158401314 18:57123700-57123722 CTTTACAGATGAGGAAACTGAGG - Intergenic
1158761481 18:60393477-60393499 ATTGACTGATGGGGAAACTAAGG - Intergenic
1159057471 18:63480117-63480139 TTTTACAGATGAGGAAAATGAGG - Intronic
1159476540 18:68928082-68928104 CTTTACAAATGAGGAAAATGAGG - Intronic
1159801997 18:72912583-72912605 CTGGACAGATCAGGAAAATGAGG - Intergenic
1159962120 18:74563549-74563571 CTTCACAGATGAGGCAAGTCAGG - Intronic
1160012888 18:75119918-75119940 CTTGATGGATAAAGAAAATCTGG - Intergenic
1160644367 19:172871-172893 TTCAACTGATGAGGAAAATGAGG + Intergenic
1161257810 19:3319613-3319635 CTTTACAGATGAGGAAACTGAGG - Intergenic
1161320666 19:3639362-3639384 CTTGACAGATGAGGAAACTGAGG - Intronic
1161566461 19:5005511-5005533 CTTTACAGATGAGGAAACTGAGG + Intronic
1161860484 19:6794337-6794359 AGTGACTGAAGAGGAAAACCAGG + Intronic
1162392616 19:10398529-10398551 TTTGACAGATGAGGAAACTGAGG - Intronic
1162397459 19:10425347-10425369 TTTGACTGATGAGGAAACTGAGG - Intronic
1162477320 19:10908309-10908331 CTTCACAGATGAGGAAACTGAGG - Intronic
1162547621 19:11339936-11339958 CTTGACGGATGGGGAAACTGAGG - Intronic
1162859088 19:13492036-13492058 TTTTACTGATGAGGAAAGGCAGG + Intronic
1163030046 19:14538121-14538143 CTTGACTGATGGAGAAACTGAGG + Intronic
1163155195 19:15436421-15436443 CTTTACAGATGAGGAAACTGAGG - Intronic
1163476894 19:17531904-17531926 TTTGACTGATGAGGAAACTGAGG + Intronic
1163517371 19:17773269-17773291 CTTTACAGATGAGGAAACTGAGG - Intronic
1163536436 19:17879508-17879530 CTTTACAGATGAGGAAATTGAGG + Intronic
1163593708 19:18208596-18208618 TTTCACTGATGAGGAAACTGAGG - Exonic
1163599059 19:18237204-18237226 CTTCACAGATGAGGAAACTGAGG - Intronic
1164908467 19:31986480-31986502 CTTTACAGATGAGGACAATGAGG - Intergenic
1165059274 19:33196944-33196966 CTTTACAGATGAGGAAACTGAGG - Intronic
1165331211 19:35142086-35142108 TTTGACAGATGAGGAAACTAAGG + Intronic
1165333957 19:35156157-35156179 TTTTACTGATGAGGAAACTGAGG + Intronic
1165804069 19:38569741-38569763 CTTTACAGATGAGGAAACTGAGG - Intronic
1165892129 19:39119583-39119605 CTTAACAGATGAGGAAATTGAGG - Intergenic
1166001325 19:39879242-39879264 CTTCACAGATGAGGAAACTGAGG + Intronic
1166004108 19:39895493-39895515 CTTCACAGATGAGGAAACTGAGG + Intronic
1166223932 19:41383393-41383415 CTTTACAGATGAGGAAAGTGAGG - Intronic
1166304886 19:41932086-41932108 TTTTACTGATGAGGAAACTGAGG + Intergenic
1167042163 19:47028629-47028651 CTTGACAGAGGAGGAAACTGAGG + Intronic
1167248559 19:48389292-48389314 CTTTACAGATGAGGAAACTGAGG - Intronic
1167281982 19:48574686-48574708 CATGACAGATGAGGAAACTGAGG + Intronic
1167550865 19:50159801-50159823 CTTGCCAGATGAGGAAAGTGAGG - Intronic
1167594172 19:50418625-50418647 GTTCACTGAAGAGGAGAATCAGG - Intronic
1167704260 19:51069397-51069419 AGTGAGTGATGAGGAAAACCAGG - Intergenic
1167705403 19:51078602-51078624 CCTGACAGATGAGGAAACTGAGG + Intronic
1167816087 19:51882341-51882363 CCTGACTGGTAAGGATAATCTGG + Intronic
1168287685 19:55342589-55342611 TTTGACGGATGAGGAAACTGAGG + Intronic
1168294460 19:55372094-55372116 CTTCACAGATGAGGAAACTGAGG - Intergenic
1168501241 19:56895395-56895417 CTTCACTGATGAAGAAACTGAGG + Intergenic
925911787 2:8578538-8578560 CTTTACAGATGAGGAAACTGGGG - Intergenic
926138328 2:10353166-10353188 TTTGACAGATGAGGAAACTGAGG - Intronic
926587765 2:14707498-14707520 CTTGACAGGTGAGGAAACTGAGG - Intergenic
926688406 2:15716203-15716225 TTTTACTGGTGAGGAAAATGAGG + Intronic
926740574 2:16107287-16107309 TTTGACTGTTGAGGAAACTGAGG + Intergenic
926819542 2:16837587-16837609 GATGGCAGATGAGGAAAATCTGG + Intergenic
927670347 2:25063581-25063603 TTTTACAGATGAGGAAAATGAGG - Intronic
927724308 2:25409380-25409402 GTTTACTGATGAGGAAAATGAGG + Intronic
928020004 2:27696919-27696941 TTTCACTGATGAGGAAAGTCAGG - Intergenic
928098201 2:28418528-28418550 CTTTACTGATGAGGAAACTAAGG - Intergenic
928258543 2:29746093-29746115 CTTTACAGATGAGGAAACTGAGG + Intronic
928590845 2:32813482-32813504 TTTTACTGATGAGGAAAGTAAGG - Intronic
928762545 2:34601827-34601849 CCTGACTGATGAGGAAGAATGGG + Intergenic
929165873 2:38881001-38881023 TTTTACAAATGAGGAAAATCAGG + Intronic
929931592 2:46260810-46260832 CTTTACAGATGAGGAAACTGAGG + Intergenic
929963319 2:46512893-46512915 CTTCACAGATGAGGAAATTGAGG + Intronic
930231334 2:48846854-48846876 TTTTACAGATGAGGAAAATGAGG + Intergenic
930610454 2:53537226-53537248 CTTCAATGATAAGGAAAATAAGG + Intronic
931209661 2:60180399-60180421 TTTTACTGATGAGGAAACTGAGG + Intergenic
931816316 2:65905308-65905330 CTAGACTGATCAGGAAAAAGAGG + Intergenic
931865753 2:66409326-66409348 ATTGACAGATGAGGAAACTGAGG + Intergenic
932169302 2:69539102-69539124 CTTTACAGATGATGAAACTCAGG + Intronic
932309038 2:70725112-70725134 CTTTACAGATGAGGAAACTGAGG - Intronic
932378192 2:71256801-71256823 CTTTACAGATGAGGAAACTGAGG - Intergenic
932414041 2:71563237-71563259 TTTGACAGGTGAGGAAATTCAGG - Intronic
932729669 2:74209841-74209863 GTTGACTGATGAGGCAAAATTGG + Intronic
934691919 2:96367865-96367887 CATTACTGAGGAGGAAAATTTGG + Intronic
934913198 2:98277506-98277528 CTTGACTGCTTTGGAAAATCTGG + Intronic
935048749 2:99505768-99505790 CTTGACTGACCAGGAGAAGCTGG + Intergenic
935930137 2:108115044-108115066 CTTTACAGATGAGGAAACTGAGG - Intergenic
936108464 2:109645708-109645730 TTTGACTGATGAGGAAATTGAGG - Intergenic
936756358 2:115717509-115717531 CTTTACAGATGAGGAAACTGAGG - Intronic
937004273 2:118496969-118496991 CTTTACAGATGAGGAAAAGGAGG - Intergenic
937053595 2:118912471-118912493 CCAGACTGAGGAGGAAAATCAGG - Intergenic
937292146 2:120788108-120788130 CTTAACAGATGAGGAAACTGAGG + Intronic
938246054 2:129778839-129778861 CTTTACAGATGAGGAAACTGAGG + Intergenic
938626654 2:133117077-133117099 CTTTACAGATGAGGAAACTGAGG - Intronic
938946391 2:136216051-136216073 TTTCACTGATGAGGAAACTGGGG - Intergenic
939627564 2:144496683-144496705 TTTTACTGATGAGGAAATTAAGG - Intronic
939657363 2:144844802-144844824 CTTGAAAGATGAGAAAAATGTGG - Intergenic
939759274 2:146154190-146154212 TTTAACTGTTGAGGAAATTCTGG + Intergenic
939921556 2:148121148-148121170 TTTTACAGATGAGGAAACTCAGG - Intronic
940813870 2:158277058-158277080 TTTGACAGATGAAGAAATTCAGG + Intronic
941097039 2:161249995-161250017 TTTTACTGATGAGAAAAATGAGG + Intergenic
941111430 2:161422418-161422440 CTTTACCGATGAGGAAATTGAGG - Intronic
941195418 2:162444963-162444985 TTTTACAGATGAGGAAAGTCAGG + Intronic
941198657 2:162481565-162481587 TTTTACTGATGAGGAAAGTCTGG - Intronic
941451940 2:165670584-165670606 TTTAACTGATGAGGAAAATGAGG - Intronic
942371021 2:175284898-175284920 CTTGACTAATGAGGAAACTGAGG + Intergenic
942691935 2:178594836-178594858 CTTGACAGATGAGGAAATAGAGG + Intronic
942930863 2:181490722-181490744 CTTTACAGATGAGGAAACTGAGG - Intronic
943235308 2:185310429-185310451 CTTGAATGATAAGAAAAATCAGG - Intergenic
943278057 2:185893563-185893585 CTTCCCTGATGAGGAGAATCTGG + Intergenic
944215188 2:197247655-197247677 TTTGGCTGATGAGGAAACTGAGG + Intronic
945453593 2:210022750-210022772 CTTGTCTGTAGATGAAAATCTGG + Exonic
945986023 2:216354270-216354292 CATTTCTGATGAGGAGAATCAGG + Intronic
946032577 2:216716781-216716803 CTTTACAGATGAGGAAACTGAGG - Intergenic
946225079 2:218260207-218260229 TTTGACAGATGAGGAAACTAAGG + Intronic
946337166 2:219045624-219045646 TTTTACAGATGAGGAAAGTCAGG - Intergenic
946451323 2:219782301-219782323 TTTTACTGATGAGGAAAGTGAGG - Intergenic
946619592 2:221546533-221546555 CTTTACAGATGAGGAAACTGAGG - Intronic
946977502 2:225169593-225169615 CTGGAATAATGAGCAAAATCTGG + Intergenic
947329453 2:229013437-229013459 GTTGTCTGCTGAGGAAAATGAGG - Intronic
947415626 2:229892488-229892510 TTTGACAGATGAGAAAACTCAGG - Intronic
947525663 2:230875299-230875321 CTTTACTGATGGGGAAACTGAGG + Intronic
947909914 2:233794135-233794157 GTTGACAAATGAGGAAACTCAGG + Intronic
948198903 2:236115333-236115355 TTTGACAGATGAGGAAAAGAGGG + Intronic
1168749433 20:271742-271764 TTTGACAGATGAGGAAACTGAGG - Intronic
1168790541 20:573082-573104 CTCTACTGAGGAGGAAAATGAGG - Intergenic
1168816359 20:740201-740223 CTTTACAGATGAGGAAACTGAGG + Intergenic
1168959455 20:1858817-1858839 TTTTACAGATGAGGAAAATGAGG + Intergenic
1168961627 20:1874088-1874110 ATTGACAGATGAGGAAACTGAGG - Intergenic
1168970353 20:1926683-1926705 CTTTACAGATGAGGAAACTGAGG + Intronic
1169015434 20:2289132-2289154 TTTGACTAATGAGGAAACCCAGG - Intergenic
1169225983 20:3857325-3857347 CTTTACTAATGAGGAAACTGAGG - Intronic
1169265428 20:4164425-4164447 TTTTACTGATGAGGAAACTGAGG + Intronic
1169574400 20:6942187-6942209 CTTGACTGATTAGGAAATTAAGG - Intergenic
1169909073 20:10632579-10632601 CATGACAGATGAGGAAACTGAGG + Intronic
1170414903 20:16129254-16129276 CTTCACGGATGAGGGAAATGAGG + Intergenic
1170425599 20:16232366-16232388 TTTGACAGTTGAGGAAAATGAGG + Intergenic
1170546643 20:17440439-17440461 ATTGTCTGATGAGGAAATACAGG - Intronic
1170554325 20:17503563-17503585 CTTTACAGATGAGGAAACTGGGG + Intronic
1170743270 20:19076412-19076434 TTTTACAGATGAGGAAACTCAGG - Intergenic
1170826138 20:19797692-19797714 CTGGATTCAGGAGGAAAATCTGG + Intergenic
1171146151 20:22785334-22785356 ATTGAATTATAAGGAAAATCTGG - Intergenic
1171306677 20:24112760-24112782 CTGGACAGATGAGGAAACTGAGG + Intergenic
1171339501 20:24416198-24416220 CTTGAAGGATGGGGAGAATCTGG + Intergenic
1171424170 20:25039181-25039203 CTTTCCTGATGAGGAAATTGAGG + Intronic
1171481307 20:25457879-25457901 CTTTACAGATGAGGAAACTGAGG + Intronic
1171519415 20:25764625-25764647 TTTTACTGATGAGTAAAATGAGG + Intronic
1171557505 20:26091866-26091888 TTTTACTGATGAGTAAAATGAGG - Intergenic
1172020351 20:31909543-31909565 CTTCACAGATGAGGAAACTGGGG - Intronic
1172048959 20:32101637-32101659 CTGGACAGATGAGGAAACTGTGG - Exonic
1172178583 20:32987138-32987160 CCTCACAGATGAGGAAAATGAGG - Intronic
1172327879 20:34051223-34051245 CTTGACAGTTGAGGAAACTAAGG + Intronic
1172572300 20:35980227-35980249 TTTGACAGATGAAGAAACTCAGG - Intronic
1172619752 20:36311170-36311192 TTTGACAGATGAGGAAACTGAGG + Intronic
1172845014 20:37925022-37925044 CTTGACAGATGAGGAAATTGAGG - Intronic
1172874536 20:38156237-38156259 CTTTACAGATGAGGAAACTGAGG - Intronic
1173170115 20:40716851-40716873 CCTGACAGATGAGGAAACTGAGG - Intergenic
1173175585 20:40762576-40762598 CTTTAGTGATGAGAAAATTCAGG + Intergenic
1173175895 20:40764642-40764664 CTTGAATGATGAAGAAACTGAGG + Intergenic
1173247544 20:41347026-41347048 CTTTACAGATGAGGAAACTGAGG - Intronic
1173317802 20:41960825-41960847 TTTTACTGATGAGGAAACTGAGG + Intergenic
1173331092 20:42077055-42077077 ATTTACTGATGAGGAAACTAAGG - Exonic
1173332435 20:42086440-42086462 TTTTACAGATGAGGAAACTCAGG - Intronic
1173578375 20:44128330-44128352 CTTTACAGATGAGGAAACTGAGG + Intronic
1173610401 20:44363172-44363194 TTTGACAGATGAGGAAACTGAGG - Intronic
1173644451 20:44624903-44624925 TTTGACAGATGAGGAAACTGAGG - Intronic
1173843425 20:46173862-46173884 TTTGACAGATGAGGAAACTGAGG + Exonic
1173958945 20:47056599-47056621 CTTTACAGATGAGGAAACTGAGG + Intronic
1174069041 20:47887194-47887216 CTGGACAGATGAGGAAACTGAGG + Intergenic
1174192578 20:48750730-48750752 TTTGACAGATGAGGAAACTGAGG + Intronic
1174357978 20:50010668-50010690 CTTGACAGATGAGAAAACTGAGG - Intergenic
1174423278 20:50414892-50414914 TTTGACAGATGAGGAAACTGAGG + Intergenic
1174518525 20:51112227-51112249 CTTGACAGAAGAGGAAACTGAGG - Intergenic
1174520598 20:51127389-51127411 TTTTACAGATGAGGAAAATAAGG - Intergenic
1174537779 20:51265959-51265981 CTTTACAGATGAGGAAACTGAGG + Intergenic
1174546712 20:51331242-51331264 CTTGCCGGATGAGGAAACTGAGG + Intergenic
1174632854 20:51973289-51973311 CTTCACAGATGAGGAAACTGAGG + Intergenic
1174858638 20:54069727-54069749 CTTTACAGATGAGGAAACTGAGG + Intronic
1174882227 20:54292550-54292572 CTTGAGAGATGAGGAAACTGAGG - Intergenic
1175187281 20:57187267-57187289 TTTTACAGATGAGGAAATTCAGG - Intronic
1175219209 20:57407420-57407442 TCTGACCGATGAGGAAAGTCGGG + Intronic
1175717577 20:61265722-61265744 CTTCACTGTTGAGGAAACTGAGG + Intronic
1175778454 20:61667384-61667406 CTTGACAGATGAGGAAACCGGGG + Intronic
1175827109 20:61942297-61942319 CTTTACAGATGAGGAAACTGAGG + Intergenic
1176007604 20:62875001-62875023 GGTGACTGATGAAGAAAATGGGG - Intergenic
1176653557 21:9570906-9570928 TTTTACTGATGAGTAAAATGAGG + Intergenic
1177405719 21:20665305-20665327 ATTGACAGATGAAGAAAATGAGG - Intergenic
1177499734 21:21937782-21937804 CTTAACTGATCAGGTATATCTGG + Intergenic
1177890980 21:26803820-26803842 CTTTACAGATGAGGAAACTGGGG + Intergenic
1178265884 21:31142272-31142294 CTTGAAAGATTAGGAAAACCAGG - Intronic
1179081090 21:38171355-38171377 CTTGACAGATAAGGAAACTGAGG + Intronic
1180578730 22:16808510-16808532 CTTTACTAATCAGGAATATCTGG - Intronic
1180592517 22:16953408-16953430 CCTGACAGATGAGGAAATCCAGG + Intergenic
1180800577 22:18630061-18630083 CCTGACAGATGAGGAAACTGAGG + Intergenic
1180817754 22:18802756-18802778 CTTTACAGATGAGGAAACTGAGG - Intergenic
1180851809 22:19025618-19025640 CCTGACAGATGAGGAAACTGAGG + Intergenic
1181117509 22:20642119-20642141 CTTAACAGATGAGGAAACTAAGG - Intergenic
1181203970 22:21237209-21237231 CTTTACAGATGAGGAAACTGAGG - Intergenic
1181221142 22:21365201-21365223 CCTGACAGATGAGGAAACTGAGG - Intergenic
1181573895 22:23782108-23782130 TTTTACTGATGAGGAAACTGAGG + Intronic
1181951541 22:26557351-26557373 TTTTACAGATGAGGAAACTCAGG - Intronic
1181966828 22:26662341-26662363 CTTTACAGATGAGGAAACTGAGG - Intergenic
1181968081 22:26670514-26670536 CTTGAAGGATGAGAAAGATCTGG + Intergenic
1182082996 22:27542547-27542569 TTTGACAGATGAGGAAACTGAGG - Intergenic
1182261456 22:29074813-29074835 CTTTACAGATGAGGAAACTGAGG - Intronic
1182463987 22:30503153-30503175 CTTGACAGATGAAGAAACTGAGG + Intronic
1182773717 22:32815338-32815360 CTTGACAGATGGGGAAACTGAGG + Intronic
1183007500 22:34915639-34915661 TTTTACTGATGAGGAAATTAAGG - Intergenic
1183157419 22:36086036-36086058 CTTGACAGGTGAGGAAACTGAGG + Intergenic
1183228658 22:36567129-36567151 CTTTACAGATGAGGAAACTGAGG - Intronic
1183385509 22:37511931-37511953 TTTTACTGATGAGGAAACTGAGG - Intronic
1183392033 22:37551105-37551127 CTTGACAGATGAGAAAACTGAGG + Intergenic
1183425426 22:37736508-37736530 CTTGACAGATGGGGAAACTGAGG + Intronic
1183444275 22:37842968-37842990 CTTTACTGAAGAGGAAACTGAGG - Intronic
1183475965 22:38035898-38035920 TTTTACTGATGAGGAAACTGAGG + Intronic
1184088160 22:42278305-42278327 CTTTACAGATGAGGAAACTGAGG + Intronic
1184218794 22:43085727-43085749 TTTTACAGATGAGGAAAATGGGG + Intronic
1184282933 22:43449297-43449319 CTTGACAGATGAGGAGACTGAGG + Intronic
1184296139 22:43526728-43526750 TTTGACAGATGAGGAAACTGAGG - Intergenic
1184381745 22:44149092-44149114 CTTGACAGATGGGGAAACTGAGG - Intronic
1184392802 22:44214636-44214658 TTTTACAGATGAGGAAACTCAGG - Intronic
1184575437 22:45361108-45361130 CATTACTGATGAGGAAATTAAGG + Intronic
1184642079 22:45878102-45878124 CTTGACAGATAAGGAAACTGAGG - Intergenic
1184808766 22:46814322-46814344 TTTGACAGATGAGGAAACTGAGG + Intronic
1184906029 22:47487342-47487364 ATTGGCTGATCAGGAACATCTGG - Intergenic
1203222951 22_KI270731v1_random:58206-58228 CTTTACAGATGAGGAAACTGAGG + Intergenic
1203267878 22_KI270734v1_random:28607-28629 CTTTACAGATGAGGAAACTGAGG - Intergenic
949181171 3:1133472-1133494 TTTTACTGATGAGGAAACTAAGG + Intronic
949449731 3:4172540-4172562 CTTTACAGATGAGGAAAGTGAGG + Intronic
949501650 3:4685875-4685897 CTTGACAGATGAGGAGACTGAGG + Intronic
950000955 3:9655872-9655894 CTTTACAGATGAGGAAACTAAGG - Intronic
950073834 3:10173145-10173167 TTTGACAGATGAGGAAACTGAGG + Intronic
950150501 3:10683176-10683198 TTTTACTGATGAGGAAACTTGGG + Intronic
950184563 3:10937209-10937231 CTTTACAGATGAGGAAACTGAGG + Intronic
950187553 3:10954410-10954432 CTTGACAGATGAGGAAACCAAGG - Intergenic
950645886 3:14376539-14376561 CTTCACAGATGAGGAAACTGAGG - Intergenic
950715883 3:14847635-14847657 CTTTACTGATGAGGAAATTGAGG + Intronic
950718226 3:14864595-14864617 CTTCACAGATGAGGAAACTGAGG - Intronic
951233608 3:20208713-20208735 CTTGACTAATGAAGAAAAGAAGG - Intergenic
952336253 3:32405561-32405583 CTTTACAGATGAGGAAACTGAGG + Intronic
952565892 3:34657291-34657313 CTTTACCAATGAGGAAAATGAGG - Intergenic
952962682 3:38602592-38602614 CTTTACAGATGAGGAAATTGAGG + Intronic
953054258 3:39375184-39375206 TTTGACAGATGAGGAAACTAAGG + Intergenic
953161114 3:40420804-40420826 TTTTACTGATGAGGAAACTGAGG - Intronic
953808080 3:46088961-46088983 TTTGACTCATGAGGAAACTGAGG + Intergenic
953973524 3:47365268-47365290 ATTGACAGATGAGGAAAATGAGG + Intergenic
953973699 3:47366923-47366945 ATTGACAGATGAGGAAAATGAGG + Intergenic
954146804 3:48638557-48638579 CTTTACAGATGAGGAAACTGAGG + Intronic
954164758 3:48747869-48747891 CTTGCCTGATGTGGACAATGTGG + Exonic
954205102 3:49052856-49052878 TTTTACAGATGAGGAAACTCAGG - Intronic
954330727 3:49888815-49888837 CTTTACAGATGAGGAAATTGAGG + Intronic
954852761 3:53617422-53617444 CTTCACAGATGAGGAAACTGAGG - Intronic
955031721 3:55228421-55228443 CTTTACAGATGAGGACAATGAGG + Intergenic
955307903 3:57852469-57852491 TTTCACAGATGAGGAAAATGAGG - Intronic
955405554 3:58623550-58623572 CTTGACAGCTGAGGAAACTGAGG + Intronic
955415533 3:58687628-58687650 TTTGACAGATGAGGAAACTGAGG - Intergenic
955419233 3:58720314-58720336 CTTGAGAGATGAGGAAACTGAGG - Intronic
955860653 3:63326182-63326204 CTTTATTGATGAGAAAAATGAGG + Intronic
955957022 3:64301302-64301324 CTTTACAGATGAGGAAACTGAGG - Intronic
956021621 3:64939416-64939438 CTTTACAGATGAGGAAACTCAGG - Intergenic
956086077 3:65611874-65611896 CTTCACTGATGAGGAAACTGAGG - Intronic
956185265 3:66556457-66556479 CTTCACAGATGAGGAAAGTGAGG - Intergenic
956187709 3:66578470-66578492 ATTTACTGATGAGGAAACTGAGG + Intergenic
956306218 3:67829911-67829933 CATGACTGATGATGGAACTCAGG - Intergenic
956504049 3:69918661-69918683 CTTCACAGATGAGGAAACTGAGG - Intronic
956525493 3:70155173-70155195 CTTTACAAATGAGGAAAATGAGG - Intergenic
956686466 3:71833426-71833448 CTTTACAGATGAGGAAATTGAGG - Intergenic
956823081 3:72971525-72971547 CTTGACTGATGAAAAAACTGAGG - Intronic
956857899 3:73294092-73294114 TTTGATAGATGAGGAAAATGTGG + Intergenic
957638504 3:82817698-82817720 TTTTACAGATGAGGAAAATAAGG - Intergenic
957842573 3:85690580-85690602 CCTGGCTGATGAGGAGAATTTGG + Intronic
958699832 3:97574388-97574410 CTTGAAGGATGAGTAAAATGTGG + Intronic
959030343 3:101292155-101292177 TTTTACTGATGAGGAAATTGAGG - Intronic
959313243 3:104768517-104768539 TTTTACAGATGAGGAAAATAGGG + Intergenic
960164402 3:114385391-114385413 TTTTACAGATGAGGAAAATGAGG - Intronic
960304775 3:116047634-116047656 TTTCACTGAGGAGGAAAATAGGG - Intronic
960737888 3:120800440-120800462 TTTGACAGATGATGAAAATGAGG - Intergenic
960942156 3:122942220-122942242 CTTTACAGATGAGGAAACTGAGG + Intronic
961066141 3:123879004-123879026 TTGGACTGAAGAGGAAACTCTGG - Intronic
961072789 3:123951135-123951157 TTTTTCTGATGAGGAAAAACAGG - Intronic
961575885 3:127835935-127835957 TTTTACTGATGAGGAAACTGAGG - Intergenic
961687176 3:128641956-128641978 TTTTACTGATGAGGAAACTGAGG + Intronic
961819883 3:129570616-129570638 CTTGACATATGAGGAAACTGAGG - Intronic
961871349 3:129990607-129990629 CTTGACAGATGAGGAAACTGAGG + Intergenic
962860000 3:139390371-139390393 ATTTAATGATGAGGAAACTCGGG + Intergenic
962920287 3:139944170-139944192 CTTTACAGATGAGGAAACTGAGG + Intronic
962962893 3:140327677-140327699 CTTGACAGATGAGGAATCTGAGG - Intronic
963297541 3:143562336-143562358 CTTGAGAGATGAGAAAAATTTGG + Intronic
963435784 3:145263869-145263891 CTTAACTGGTGAGGAAACTGAGG - Intergenic
963685007 3:148422063-148422085 CTAGACTGAAGAGCAGAATCAGG + Intergenic
963866325 3:150365709-150365731 CTTGCCAAATGATGAAAATCAGG - Intergenic
963951008 3:151200868-151200890 CTTTACAGATGAGGAAATTGAGG + Intronic
964172015 3:153782315-153782337 CTTTACAGATGAGGAAACTGAGG + Intergenic
964251009 3:154717367-154717389 CTTCACTGATAAGGAAATGCCGG + Intergenic
964257167 3:154788847-154788869 CTTGTCTGATGAGAGAAATGAGG - Intergenic
964495536 3:157285882-157285904 CTTTACTGATGAGGAAACTGAGG - Intronic
964496844 3:157300354-157300376 CTTGACTGATGCAGAACATCTGG + Intronic
964672880 3:159246445-159246467 TTTCACGGATGAGGAAAAACAGG + Intronic
965371889 3:167873024-167873046 TTTTACAGATGAGGAAAATGAGG + Intergenic
965620384 3:170637054-170637076 CTTAACAGATGAGGAAAGTGGGG - Intronic
965736933 3:171830360-171830382 CTTTCCTCATGAGGAAAAGCTGG + Intergenic
966228562 3:177625323-177625345 CTTGAGGGATGAGGAAACTGGGG + Intergenic
966330680 3:178809447-178809469 CTTCACAGATGAGGAAACTGAGG + Intronic
966421319 3:179737272-179737294 CTTGACAGATGGGGAAACTGAGG - Intronic
966758607 3:183394435-183394457 CTTGACCACTGAGGAAACTCTGG + Intronic
967290800 3:187918283-187918305 CTTTACAGATGAGGAAAGTGAGG + Intergenic
967415175 3:189209040-189209062 TTTAACTTATGAGGAAAAACTGG + Intronic
967797601 3:193614467-193614489 TTTTACAGATGAGGAAAATGTGG - Intronic
968091041 3:195898358-195898380 CTTTACAGATGAGGAAATTGAGG - Intronic
968925409 4:3544588-3544610 CTTTACTGATGAGGAAATTAAGG + Intergenic
968954733 4:3712397-3712419 CTTTACTGATGGGGAAACTGAGG + Intergenic
969173537 4:5382841-5382863 CTTTACAGATGAGGAAACTGAGG + Intronic
969257261 4:6010949-6010971 CTTCACAGATGAGGAAACTGAGG + Intergenic
969348024 4:6581348-6581370 TTTGACAGATGAGGAAACTGAGG + Intronic
969373626 4:6749323-6749345 TTTGACAGATGGGGAAAATGAGG + Intergenic
970135718 4:12921075-12921097 CTTGACTCATGAAAAGAATCAGG + Intergenic
970178287 4:13361619-13361641 TCTGACAGATGAGGAAAATGAGG - Intronic
970243927 4:14038857-14038879 TTTTACAGATGAGGAAAATGAGG + Intergenic
970337539 4:15065544-15065566 CTTGACAGATGTGGAAACTGAGG + Intronic
970518395 4:16858176-16858198 CTTTACAGATGAGGAAACTGAGG + Intronic
970640260 4:18056731-18056753 TTTGACAGATGAGGAAACTGAGG + Intergenic
970816131 4:20158316-20158338 TATAATTGATGAGGAAAATCTGG + Intergenic
970958411 4:21842857-21842879 CTTTACAGATGAGGAAATTAAGG - Intronic
971206486 4:24574694-24574716 CTTTACAGATGAGCAAAATGAGG - Intronic
971236550 4:24847655-24847677 CTTTACAGATGAGGAAACTGAGG + Intronic
971339571 4:25755449-25755471 CTTTACAGATGAGGAAACTGAGG - Intronic
972318498 4:37950248-37950270 TTTTACAGATGAGGAAAATGAGG - Intronic
972456636 4:39262091-39262113 CTTTACTGATGGGGAAACTGAGG + Intronic
973048842 4:45569611-45569633 TTTGACAGATGAGGAAATTGAGG - Intergenic
973110045 4:46387919-46387941 GTCCACTGATGATGAAAATCAGG + Intronic
973180140 4:47256934-47256956 CTTTACAGATGAGGAAACTATGG + Intronic
973337893 4:48974971-48974993 CTTTACAGATGAGGAAACTGAGG + Intergenic
973829759 4:54747023-54747045 TTTTACAGATGAGGAAAATAAGG + Intergenic
974905782 4:68054949-68054971 TTTGACTGATAAGGAAAAACAGG + Intronic
975665331 4:76729154-76729176 CTTCATTGATAAGGAAACTCAGG + Intronic
975678127 4:76848071-76848093 TTTTATTGATGAGGAAAATGAGG - Intergenic
975930115 4:79511089-79511111 ATTTACAGATGAGGAAATTCAGG - Intergenic
976225533 4:82792781-82792803 CTTTACAGATGAGGAAACTGAGG + Intronic
977183004 4:93900891-93900913 CATGACTTATGAGCAAAAACTGG - Intergenic
977241855 4:94581076-94581098 TTTCACTGTTGAGGAAAATGAGG + Intronic
977665540 4:99643269-99643291 TTTTACAGATGAGGAAAATGAGG + Intronic
978198790 4:106000672-106000694 CTTTACAGATGAGGAAACTGAGG - Intronic
978631558 4:110752999-110753021 TTTTACTGATGAGGAAATTGAGG - Intergenic
978958539 4:114645363-114645385 CTTACCTGATAAGGAAAATGGGG - Intronic
979197165 4:117933571-117933593 CTTGCCTGTTGAGGAAACACGGG + Intergenic
979286197 4:118927408-118927430 TTTGACAGATGAGGAAACTGAGG + Intronic
979533202 4:121791260-121791282 CTTTACAGATGAGCAAAATGAGG - Intergenic
979597679 4:122552645-122552667 CTTCACAGATGAGGAAACTATGG - Intergenic
980786391 4:137561574-137561596 CTTTACAGATGAGGAAACTGTGG - Intergenic
981162995 4:141521565-141521587 CACCACTGATGAGGAAAAGCAGG - Intergenic
981217374 4:142186316-142186338 CTTTACAGATGAGGAAACTAAGG + Intronic
981410343 4:144422820-144422842 ATTTACTGAGAAGGAAAATCAGG + Intergenic
981915714 4:150030851-150030873 CTTTACAGATGAGGAAACTAAGG - Intergenic
982132231 4:152239946-152239968 CTTGACAGATGAGTAAACTGAGG + Intergenic
982993380 4:162308796-162308818 CTTTACAGATGAGGAAACTGAGG + Intergenic
983280864 4:165679464-165679486 ATTAACAGATGAGGAAAATTTGG - Intergenic
983393486 4:167163761-167163783 ATTTGCTGATTAGGAAAATCTGG - Intronic
983859142 4:172682991-172683013 TTCTACTGATGAGGAAAATGAGG + Intronic
983946872 4:173596114-173596136 CTATCCTGATGAGGAAACTCAGG + Intergenic
984184637 4:176528788-176528810 GTTTACTGATGAGGAAAACAAGG - Intergenic
984475417 4:180228760-180228782 CTTGACTTAAGATGACAATCTGG + Intergenic
984906086 4:184627061-184627083 CTATAGTGTTGAGGAAAATCTGG - Intergenic
985166450 4:187099965-187099987 CTGAACTGTTGAGGAGAATCAGG + Intergenic
985860945 5:2470340-2470362 GTTGACTGATGAGGAGAAGGGGG + Intergenic
986080903 5:4393279-4393301 CTGGAGTGAGGAGGAAAAACAGG - Intergenic
987816239 5:22904410-22904432 ATAGACTGATGAAGAAAATGTGG + Intergenic
988495071 5:31737927-31737949 CTTTTCTGATGAGGAAACTGAGG + Intronic
988785726 5:34564227-34564249 CTTGACAGATGAGGACAGTGAGG - Intergenic
988993970 5:36696850-36696872 TTTCACTGATGAAGAAAATGAGG + Intergenic
989228635 5:39060938-39060960 TGTAACTGATGAGGAAAATGGGG - Intronic
989406481 5:41066927-41066949 CTTCACAGATGAGGAAACTGAGG - Intronic
990208331 5:53453961-53453983 GTTTACAAATGAGGAAAATCAGG + Intergenic
990343065 5:54843806-54843828 GTTTACTGATGAGGAAATTAAGG - Intergenic
992410235 5:76498372-76498394 TTTGACAGATGAGGAAACTGAGG + Intronic
992629297 5:78665389-78665411 TTTCACTGATGAGGAAACTGAGG - Intronic
992658603 5:78935769-78935791 CTTTGCTGATGAAGAAAATAAGG + Intronic
993111310 5:83660802-83660824 ATTTACTGATGAGGAAACTGAGG - Intronic
993508418 5:88740479-88740501 TTTGACAGATGAGGAAACTGAGG + Intronic
994490311 5:100434092-100434114 TTTTACTGATGAGGAAATTGAGG - Intergenic
995039609 5:107572538-107572560 CTTGACTACTGGAGAAAATCTGG + Intronic
995314652 5:110754683-110754705 TCTTACTGATGAGAAAAATCAGG - Intronic
995669676 5:114588101-114588123 CTTCACTGATAAAGAAACTCAGG - Intergenic
995714086 5:115064829-115064851 TTTGCCTGAAGAGGAAAATGAGG - Intergenic
995871314 5:116746418-116746440 TATTACTGATGAGGAAAATAAGG + Intergenic
996412179 5:123170333-123170355 CTTGACTGATGGAGAATTTCAGG - Intronic
996699801 5:126438849-126438871 GTTGATTGATGAGGAGAATATGG + Intronic
996767878 5:127053094-127053116 GTGGACTGATTAGGAAAAACAGG - Intronic
997193797 5:131963896-131963918 TTTCACAGATGAGGAAAATGAGG + Intronic
997330534 5:133057999-133058021 CTAAACTGATGAGGAAAGGCTGG + Intronic
997465285 5:134084000-134084022 TTTTACAGATGAGGAAAATGAGG - Intergenic
997594436 5:135096628-135096650 CTTAACAGATGAGGAAACTTGGG - Intronic
997717427 5:136052643-136052665 CTTGACTGATAAGGAAGTTGAGG + Intronic
997779598 5:136643572-136643594 CTTGATGGATGAGGAAACTGAGG - Intergenic
998092138 5:139377692-139377714 CTTTACAGATGAGGAAGATGAGG - Intronic
998575944 5:143316660-143316682 GTTTACTGATGAGGAAACTCAGG - Intronic
998977842 5:147668015-147668037 CTTCACTGAGGAAGAAAATGAGG - Intronic
999188103 5:149727841-149727863 CTTTACAGATGAGGAAACTGAGG + Intergenic
999275397 5:150326523-150326545 CTTTACAGATGAGGAAATTGAGG + Intronic
999366979 5:151029654-151029676 TTTGACGGATGAGGAAACTGAGG + Intergenic
999382596 5:151131893-151131915 CTTAACAGATGAGGAAACTGAGG + Intronic
999431025 5:151525559-151525581 CTTTACAGATGAGGAAACTGAGG - Intronic
999617100 5:153436203-153436225 CTTTACAGATGAGGAAATTGAGG - Intergenic
999639609 5:153659069-153659091 ATTGACAGATGAGGAAACTGAGG - Intronic
999837217 5:155387284-155387306 CTTGACTGATAAAGAAACTGAGG - Intergenic
1000596441 5:163220065-163220087 GTTTACAGATGAGGAGAATCAGG + Intergenic
1000682793 5:164207231-164207253 CTTTACTGATGAAGTAAATGAGG + Intergenic
1000721904 5:164718620-164718642 ATCGACTGATAAGGAAAATGCGG - Intergenic
1000767033 5:165304871-165304893 CTTGACAAATGAGGAAAATGAGG + Intergenic
1001114635 5:168929428-168929450 TTTTACTGATGAGGAAACTGAGG + Intronic
1001573038 5:172743258-172743280 CTTCACTGAAGAGGAAACTCAGG - Intergenic
1001704221 5:173730236-173730258 CTTGACAGATGAGGAAACTGAGG - Intergenic
1002732557 5:181351909-181351931 TTCAACTGATGAGGAAAATGAGG - Intergenic
1002751982 6:122199-122221 TTCAACTGATGAGGAAAATGAGG + Intergenic
1002857233 6:1048726-1048748 CTGGTCTGATGATGAAAACCTGG - Intergenic
1003453076 6:6255355-6255377 TTTCACTGATGAGGAAACTGAGG + Intronic
1003735024 6:8868569-8868591 TTTGACAGATGAGGAAACTGAGG - Intergenic
1004970075 6:20899904-20899926 TTTTACTGATGAGGAAACTAAGG + Intronic
1005270200 6:24155507-24155529 CTTGATAGATGAGGAAACTGAGG - Intergenic
1005442787 6:25889088-25889110 CATGACAGATGAGGAAACTGAGG + Intergenic
1006364373 6:33606725-33606747 CTTGACAGATGAGAAAACTGAGG - Intergenic
1006790801 6:36699743-36699765 TTTGACAGATGAGGAAACTGAGG - Intronic
1006874444 6:37283001-37283023 CTTGCCTGATGAGGTTAGTCTGG + Intronic
1006947708 6:37796383-37796405 CTTGACAGATGAGGACACTAAGG + Intergenic
1007417279 6:41699125-41699147 CTTGACTGATGGGGAGACTGAGG - Intronic
1007442463 6:41874581-41874603 TTTGACAGATGAGGAAACTGTGG + Intronic
1007460135 6:42011941-42011963 TTTGACAGATGAGGAAATGCAGG - Intronic
1007474256 6:42108252-42108274 TTTGACAGATGAGGAAACTGAGG - Intronic
1007542962 6:42666919-42666941 CTTGACAGATGAGGGAATTGAGG - Intronic
1007708135 6:43803994-43804016 TTTTACTGATGAGGAAACTAAGG - Intergenic
1007714842 6:43849873-43849895 CTTTACAGATGAGGAAAGTGAGG + Intergenic
1008011971 6:46477500-46477522 TTTGACAGATGAGGAAACTGAGG - Intronic
1008496903 6:52143394-52143416 TTTTACAGATGAGGAAAATGAGG - Intergenic
1008497831 6:52151105-52151127 CTTTACAGATGAGGAAACCCAGG - Intergenic
1008593086 6:53013308-53013330 TTTTACAGATGAGGAAAATGAGG + Intronic
1008731179 6:54484412-54484434 CTTGACAGATGGGGAAATTATGG - Intergenic
1008980550 6:57478752-57478774 CTTTACAGATGAGGAAACTTAGG - Intronic
1009168655 6:60371705-60371727 CTTTACAGATGAGGAAACTTAGG - Intergenic
1010520611 6:76829990-76830012 CTTTACAGATGAGGAAACTGAGG - Intergenic
1010712444 6:79191062-79191084 TTTTACAGATGAGGAAACTCAGG - Intergenic
1011598018 6:89034834-89034856 TTTGACTGATGACGTAAATGAGG + Intergenic
1012937606 6:105384361-105384383 TGTGACTGATGAGGAACATCTGG + Intronic
1013185893 6:107757629-107757651 CTTTACAGATGAGGAAAGGCAGG - Intronic
1013275459 6:108580498-108580520 CTTTACTCATGAGGAAACTGAGG + Intronic
1013542845 6:111128288-111128310 TTTTACAGATGAGGAAAATGAGG + Intronic
1013970109 6:116007354-116007376 GTTTACAGATGAGGAAACTCAGG + Intronic
1014511701 6:122330564-122330586 ATTGACTTATGATGAAAAGCAGG - Intergenic
1015178381 6:130336278-130336300 CTTTACAGATAAGGAAAATGAGG + Intronic
1016730413 6:147422110-147422132 CTTGGCTGAAGAGGTAAATTTGG - Intergenic
1016824745 6:148377921-148377943 TTTTACAGATGAGGAAAATGAGG + Intronic
1017075721 6:150615986-150616008 CTTCACAGATGAGGAAACTGAGG + Intronic
1017111181 6:150934192-150934214 CTTGATAGATGAGGAAACTGAGG - Intronic
1017266509 6:152452241-152452263 GATGACTGATGAGAAAAATGAGG + Intronic
1018156931 6:160993479-160993501 TTTGACAGATGAGGAAACTGAGG + Intronic
1018171192 6:161144354-161144376 CACTACTGATGAGGAAATTCAGG - Intronic
1018768720 6:166954470-166954492 CTTTACAGATGAGGAAACTGGGG + Intronic
1018854252 6:167664114-167664136 CCTGCCTGACGTGGAAAATCTGG + Intergenic
1019236809 6:170624228-170624250 TTCAACTGATGAGGAAAATGAGG - Intergenic
1019501713 7:1368203-1368225 CTTGACAGATGGGGAAACTGAGG - Intergenic
1019807908 7:3142144-3142166 TTTGACTGTTGAGGAAACTGAGG + Intronic
1019997201 7:4732259-4732281 TTTGGCTGATGAGGGAAACCAGG + Intronic
1020287753 7:6698384-6698406 CTGGACTGATGATGTAAATTTGG - Intronic
1022474038 7:30698870-30698892 TTTTACTGATGAGGAAACTGAGG + Intronic
1022593641 7:31690363-31690385 TTTTACAGATGAGGAAACTCAGG + Intronic
1022614094 7:31910756-31910778 CTTGACAGAGGAGGAAACTGAGG - Intronic
1023185556 7:37529352-37529374 TTTTACTGATGAGGAAACTGAGG + Intergenic
1023257174 7:38323569-38323591 CTTTACAGATGAGGAAAAAGAGG - Intergenic
1023294782 7:38703212-38703234 CTTTACTGAAGAGGAAAATGTGG + Intergenic
1023766375 7:43514854-43514876 TTTTACAGATGAGGAAAATGAGG + Intronic
1023949017 7:44826394-44826416 TTTTACAGATGAGGAAATTCAGG - Intergenic
1024600175 7:50973773-50973795 CTGGCCTGATGAGAAAAACCAGG - Intergenic
1024892910 7:54223828-54223850 CTTGGCTGTTGCGGAAAGTCAGG - Intergenic
1024901008 7:54318559-54318581 CTTGGCTGTTGCGGAAAGTCAGG + Intergenic
1025244887 7:57309394-57309416 CTTTACAGATGAGGAAACTGAGG + Intergenic
1025279899 7:57619565-57619587 TTTTACTGATGAGTAAAATGAGG + Intergenic
1025304835 7:57845936-57845958 TTTTACTGATGAGTAAAATGAGG - Intergenic
1025613903 7:63101748-63101770 ATTGACAGATGAGGAAACTAAGG - Intergenic
1026199479 7:68201782-68201804 TTTAACAGATGAGGAAAATTAGG + Intergenic
1026343319 7:69452706-69452728 CTTTACAGATGAGGAAATTGAGG - Intergenic
1027046452 7:74994397-74994419 TTTGACAGATGAGGAAACTGAGG - Intronic
1027244290 7:76356299-76356321 TTTTACAGATGAGGAAAATGAGG + Intronic
1027306494 7:76903388-76903410 CTTGACAGATGAAGAAACTGAGG + Intergenic
1027306600 7:76904732-76904754 CTTTACAGATGAGGACACTCTGG + Intergenic
1027767219 7:82359972-82359994 CTTTACAGATGAGGAAACTGAGG + Intronic
1028239093 7:88397730-88397752 TTTTACAGATGAGGAAAATGGGG - Intergenic
1028272051 7:88803776-88803798 CTGGACTTATGATGAAAATTTGG + Intronic
1028400125 7:90416533-90416555 CTCCATTGATGAGGCAAATCTGG - Intronic
1029003422 7:97180905-97180927 ATTTACTGATGAGGAAAAATAGG + Intronic
1029055851 7:97741909-97741931 TTTTACTGATGAGGAAAATAAGG - Intergenic
1029799982 7:102936262-102936284 ATTTACAGATGAGGAAAATGAGG + Intronic
1030064771 7:105651243-105651265 TTTGACTGATAAGGAAACTGAGG - Intronic
1030125521 7:106149360-106149382 TTTTACTGATGAGGAAACTGAGG - Intergenic
1030433260 7:109480680-109480702 CTTTACTGACCAGGAAAATGAGG + Intergenic
1030989627 7:116284392-116284414 CTTTACAGATGAGAAAAATGAGG - Intergenic
1031980815 7:128123160-128123182 TTTTACTGATGAGGAAACTGAGG + Intergenic
1032026665 7:128448165-128448187 CTTCACAGATGAGGAAACTGAGG + Intergenic
1032826043 7:135568841-135568863 TTTGAAGGATGAGGAAAATCTGG - Intronic
1032840730 7:135711538-135711560 GTTTACTGATGAGGAAACTGGGG + Intronic
1032847935 7:135767897-135767919 CTTTACAGATGAGGAAAGTGAGG + Intergenic
1033017096 7:137682396-137682418 TGTGACTGATGAGTAAAATAGGG - Intronic
1033956991 7:146861710-146861732 CAAGGCTGATGAAGAAAATCAGG - Intronic
1035025669 7:155823775-155823797 TTTGACAGATGAGGAAATTTAGG + Intergenic
1035059705 7:156059845-156059867 CTTGATAGATGAGGAAACTGAGG + Intergenic
1035510963 8:182382-182404 TTCAACTGATGAGGAAAATGAGG + Intergenic
1035918295 8:3649684-3649706 CTTGACACATGAGGATTATCGGG + Intronic
1036133688 8:6139613-6139635 CTTTACAGATGAGGAAACTGAGG - Intergenic
1037002643 8:13738966-13738988 TTTCACTGATGAGGAAACTGAGG - Intergenic
1037670900 8:21014601-21014623 TTTGACAGATGAGGAAATTATGG - Intergenic
1037718725 8:21422534-21422556 TTTGACAGATGTGGAAAATGAGG + Intergenic
1037826545 8:22163780-22163802 CTTTACTGATGAGAAAACTGAGG + Intronic
1037828624 8:22175197-22175219 TTTGACAGATGAGGAAACTAAGG - Intronic
1038442708 8:27583180-27583202 CTTTACAGATGAGGAAACTGAGG + Intergenic
1038668878 8:29565192-29565214 CTTTAATGATGAGGAAATTGAGG + Intergenic
1038766092 8:30429156-30429178 CTTTACAGATGAGGAAACTGAGG + Intronic
1038842274 8:31196013-31196035 ATTTACAGATGAGGAAAATAAGG + Intergenic
1039887985 8:41666124-41666146 CTTCACAGATGAGGAAACTGAGG - Intronic
1039927871 8:41954686-41954708 CTTTACAGATGAGGAAACTGAGG + Intronic
1041253418 8:55957151-55957173 CTTCACTGATGTGGAAACTGAGG - Intronic
1042194443 8:66220545-66220567 TTTAATTGATGAGGAAAATAAGG + Intergenic
1042427658 8:68667457-68667479 CTGGACTTAACAGGAAAATCTGG - Intronic
1042479652 8:69288837-69288859 CTTTACAGATGAGGAAACTGAGG - Intergenic
1042682510 8:71401648-71401670 TTTGACTGATGAAGAAACTGAGG - Intergenic
1043387398 8:79761788-79761810 TTTGACAGATGAGGAAAGTGGGG + Intergenic
1043514833 8:80986361-80986383 GTTTACTGATGAGGAAACTGTGG - Intronic
1043999353 8:86859791-86859813 CTTTACAGATGAGGAAAATGAGG - Intergenic
1044410717 8:91879683-91879705 CTTAACAGATAAGGAAAATAAGG + Intergenic
1044616654 8:94149367-94149389 ATTGAGTGCTGAGGAAGATCAGG + Intronic
1044687712 8:94843831-94843853 GTTGACTGATGAGAACACTCAGG - Intronic
1045287162 8:100801928-100801950 TTTTACAGATGAGGAAACTCAGG - Intergenic
1046078084 8:109335841-109335863 TTTTACTGATGAGGAAACTGAGG - Intronic
1046094163 8:109538642-109538664 TTTTACTGATGAGGAAATTGAGG + Intergenic
1047067346 8:121300176-121300198 CTTTACTAATGGGGAAAATAAGG + Intergenic
1047361756 8:124175554-124175576 CTTTACAGATGAGGAAAGTGAGG + Intergenic
1047420454 8:124703739-124703761 TTTTACTGATGAGGAAACTGAGG - Intronic
1047489305 8:125361545-125361567 CTTTACAGATGAGGAAACTGAGG - Intronic
1047638455 8:126792645-126792667 CTTTATAGATGAGGAAACTCTGG - Intergenic
1047723325 8:127662800-127662822 CTTTACAGATGAGGAAACTGAGG - Intergenic
1047862249 8:128980655-128980677 ATTTACAGATGAGGAAATTCAGG - Intergenic
1048294381 8:133203508-133203530 GTTCACAGATGAGGAAAATGAGG - Intronic
1048335712 8:133500644-133500666 CTTTACAGATGAGGAAACTGAGG - Intronic
1048456177 8:134580155-134580177 GTTTACTGATGAGGAAAGTGAGG + Intronic
1048724376 8:137365690-137365712 GTTGAAAGATGAGGAAAATAAGG - Intergenic
1048850659 8:138642290-138642312 CTTTACAGATGAGGAAACTAAGG - Intronic
1049195650 8:141314261-141314283 CCTCACTGATGAGGAAACTGAGG - Intergenic
1049202699 8:141349710-141349732 CTTGACAGAGGAGGAAACTGAGG + Intergenic
1049225609 8:141449169-141449191 CTGGGCTTATGAGGAAAACCAGG + Intergenic
1049231558 8:141487583-141487605 TTTGACAGATGAGGAAACTAAGG + Intergenic
1049278845 8:141733848-141733870 GTTGACAGATGAGGAAACTGAGG - Intergenic
1049388336 8:142355330-142355352 CTTCACAGATGAGGAAACTGAGG - Intronic
1049444331 8:142623129-142623151 CTTTACAGATGAGGAAACTGAGG + Intergenic
1050472229 9:6006271-6006293 CTTGATAGATGAGGAAACTGAGG + Intronic
1050609092 9:7332654-7332676 CTTTTGTAATGAGGAAAATCAGG - Intergenic
1050686193 9:8172104-8172126 CTTTACTGATGAAGAAATTGAGG + Intergenic
1050763612 9:9105163-9105185 TTTAACTGATGAGGAAAAAGTGG + Intronic
1051187006 9:14470861-14470883 CTTGACAGATGAGGAAACTGAGG - Intergenic
1051485029 9:17598816-17598838 TTTTACTGATGAGGAAACTAAGG + Intronic
1051605551 9:18914871-18914893 CTTGATTATTGAGGAACATCTGG + Intergenic
1051931493 9:22391657-22391679 TTTTATTGATGAGGAAAATGAGG - Intergenic
1052008293 9:23376600-23376622 CTTGACTGATGATTGAAATCAGG - Intergenic
1052330612 9:27263963-27263985 TTTTACAGATGAGGAAAATGAGG + Intergenic
1052343367 9:27384486-27384508 CTGGACTAATGAAAAAAATCTGG + Intronic
1052785676 9:32826041-32826063 CTTGATGGATGAGGAAAACAAGG + Intergenic
1052838966 9:33274939-33274961 TTTTACAGATGAGGAAAATAAGG + Intronic
1052873190 9:33528422-33528444 CTTTATTAATGAGGAAATTCAGG + Intronic
1053502910 9:38616327-38616349 CTTTATTAATGAGGAAATTCAGG - Intergenic
1053800303 9:41759770-41759792 CTTTACTGATGAGGAAATTAAGG + Intergenic
1054144895 9:61555065-61555087 CTTTACTGATGAGGAAATTAAGG - Intergenic
1054188730 9:61971922-61971944 CTTTACTGATGAGGAAGTTAAGG + Intergenic
1054464587 9:65486022-65486044 CTTTACTGACGAGGAAATTAAGG - Intergenic
1054649791 9:67616695-67616717 CTTTACTGATGAGGAAATTAAGG - Intergenic
1054731087 9:68703878-68703900 CTTTACAGATGAGGAAACTAAGG - Intergenic
1054805506 9:69393066-69393088 TTTGACAGATGTGGAAAATGAGG + Intergenic
1054972108 9:71099820-71099842 CTTTACAGATGAGGAAACTGAGG + Intronic
1055317701 9:75050468-75050490 CTTTTCAGATGAGGAAAATGAGG - Intergenic
1055429127 9:76226387-76226409 CTTGACTGGTGAGGAAATGAGGG - Intronic
1056333045 9:85537602-85537624 CTTGACAGGTGTGGAAATTCAGG + Intergenic
1056341906 9:85643372-85643394 TTTAACTGAAGAGGAAAATGAGG + Intronic
1057412281 9:94827321-94827343 CTTTACAGATGAGGAAAGTGAGG + Intronic
1057483160 9:95461635-95461657 TTTGACAGATGAGGAAAGTGAGG + Intronic
1057683378 9:97211772-97211794 CTTTATTAATGAGGAAATTCAGG - Intergenic
1057859776 9:98631326-98631348 CTTTACAGATGAGGAAACTGAGG - Intronic
1058177750 9:101757188-101757210 CTTTACAGATGAGGAAACTGAGG + Intergenic
1058455080 9:105131211-105131233 TTTGACAGATGAGGAAACTGAGG + Intergenic
1058472555 9:105295829-105295851 TTTCACAGATGAGGAAACTCAGG - Intronic
1058597214 9:106628242-106628264 CTTTACTGATGATGAAACTGAGG - Intergenic
1058759856 9:108120065-108120087 CTTGACAGATGAGAAAACTGAGG + Intergenic
1059075609 9:111190633-111190655 CTTGACTGATGATAAACACCAGG + Intergenic
1059435285 9:114272224-114272246 CTAGACGGATGAGGAAACTGAGG + Intronic
1059443567 9:114324531-114324553 TTTTACAGATGAGGAAAATGAGG - Intronic
1059447369 9:114346963-114346985 CTTGACAGATGAGGAAACTGAGG - Intronic
1059700780 9:116773707-116773729 TTTCACAGATGAGGAAACTCTGG + Intronic
1059749375 9:117233371-117233393 CTTGACTGATGAGGAAAATCAGG - Intronic
1060185874 9:121563872-121563894 CTTGACTGGTGAAGAAAGTGAGG + Intergenic
1060190706 9:121590544-121590566 TTTGACAGATGAGGAAACTGAGG - Intronic
1060283868 9:122231827-122231849 CTTTACAGATGAGGAAACTGAGG - Intergenic
1060284101 9:122233645-122233667 CTTAACAGATGAGGAAACTGAGG - Intergenic
1060470898 9:123947349-123947371 CTTTACAGATGAGGAAACTGAGG + Intergenic
1060495329 9:124114166-124114188 TTTTACAGATGAGGAAAATAAGG - Intergenic
1060513700 9:124252374-124252396 TTTGACAGATGAGGAAACTGAGG + Intergenic
1060524197 9:124311358-124311380 TTTGCCTGATGAGGAAACTGAGG - Intronic
1060525085 9:124315891-124315913 CTTTACAGATGAGGAAACTGAGG - Intronic
1060664874 9:125426916-125426938 TTTGACAGATGAGGAAACTGAGG + Intergenic
1060729643 9:126029298-126029320 TTTTACAGATGAGGAAAATGAGG + Intergenic
1060796955 9:126518951-126518973 CTTGACAGATGAGAAAACTGAGG + Intergenic
1060925531 9:127452689-127452711 CTTTACAGATGAGGAAACTGAGG + Intronic
1060965287 9:127709034-127709056 TTTGACAGATGAGGAAACTGAGG - Intronic
1061616119 9:131780267-131780289 CTTTGCTGATGAGGAAACTGAGG - Intergenic
1061923058 9:133792794-133792816 CATGACAGATGAGGAAACTGAGG + Intronic
1061953903 9:133951625-133951647 CTTGACAGGTGAGGAAACTGAGG - Intronic
1062087319 9:134655483-134655505 CTTGACAGATGGGGAAACTGAGG - Intronic
1062174538 9:135153647-135153669 TTTGACTGATGAGGAAACCAAGG - Intergenic
1062756959 9:138304234-138304256 TTCAACTGATGAGGAAAATGAGG - Intergenic
1203631277 Un_KI270750v1:74353-74375 TTTTACTGATGAGTAAAATGAGG + Intergenic
1185629813 X:1507801-1507823 CTTGACAGAAGAGGAAATTGAGG + Intronic
1186555711 X:10556166-10556188 CTAGACAGATGAGGAAAAGATGG - Intronic
1186657274 X:11627703-11627725 CTTTACAGATGAGGAAACTGAGG - Intronic
1187662129 X:21560403-21560425 TTTAACTGATGAGGAAACTAAGG - Intronic
1187679372 X:21751508-21751530 CTTGATAGATGAGGAAACTGAGG + Intronic
1188011399 X:25060059-25060081 CTTTGCAGATGAGGAAACTCAGG - Intergenic
1188320178 X:28726736-28726758 CTTTACAGATGAGGAAACTGAGG + Intronic
1189074261 X:37899436-37899458 CTTAACTGATTAGGAAACTTAGG + Intronic
1189124310 X:38429755-38429777 CCTGACTGATGAGAATAATTGGG + Intronic
1189366769 X:40394904-40394926 CTTGACAGATGAGGAAACTGAGG - Intergenic
1189758513 X:44297139-44297161 CTTGACAGATGAGGGAATTCAGG + Intronic
1190305074 X:49077298-49077320 CTTTACCGATGAGGAAACTGAGG - Intronic
1190430949 X:50377392-50377414 TTTTACAGATGAGGAAAATGAGG - Intronic
1190823364 X:53995046-53995068 CTTTACAGATGAGGAAACTGAGG + Intronic
1192152105 X:68718853-68718875 CTTTACAGATGAGGAAACTGAGG - Intronic
1192261468 X:69508293-69508315 TTTTACAGATGAGGAAACTCAGG + Intronic
1192433920 X:71130653-71130675 TTTGACCGATGAGGAAACTGAGG + Intronic
1192539890 X:71958855-71958877 CTTTACAGATGAGGAAACTGAGG + Intergenic
1192703739 X:73505580-73505602 ATTGACTTATGAGGGAAATTTGG + Intergenic
1193027763 X:76863332-76863354 CTTTATAGATGAGGAAAATAAGG + Intergenic
1193504512 X:82325329-82325351 CTGGACTAATGAAGAAAATAGGG - Intergenic
1194739396 X:97554723-97554745 TTTTACAGATGAGGAAAATGAGG - Intronic
1195430250 X:104781263-104781285 CTTTACAGATGAGGAAATTGGGG + Intronic
1195773802 X:108380841-108380863 TTTTACAGATGAGGAAAATGAGG - Intronic
1195885573 X:109634049-109634071 CTTGAAGGATGAGTAAAATTTGG - Intronic
1195937956 X:110143186-110143208 ATTGACAGATGAGGAAACTGAGG - Intronic
1196047400 X:111270611-111270633 CCTGAGTCATGAGGAAAATGTGG + Intergenic
1196200060 X:112876257-112876279 CTTGACAGACGAAGAAATTCGGG - Intergenic
1196300932 X:114049177-114049199 CTTCACGGATGAGGAAACTGAGG - Intergenic
1196504166 X:116421221-116421243 TTTTACTGATGAGGAAAGTGTGG - Intergenic
1196644732 X:118105429-118105451 CTTTACAGATGAGGAAACTGAGG - Intronic
1196649689 X:118156216-118156238 TTTTACTGATGAGGAAACTGAGG - Intergenic
1197664911 X:129213095-129213117 CATGGCTTATGAGGAAAATGGGG + Intergenic
1198431386 X:136570262-136570284 ATTGGCTGATGAGGAAACTGAGG + Intergenic
1198471030 X:136947105-136947127 CTTGACTGTTGAGGAACAAGGGG - Intergenic
1198523238 X:137473834-137473856 CCTGAATGATGAGGAAAACATGG + Intergenic
1198810744 X:140533900-140533922 TTTGACAGATGAGGAAATTGTGG + Intergenic
1199219049 X:145296034-145296056 TTTCACTGATGAGGAAGATGAGG + Intergenic
1199473810 X:148224193-148224215 CTTCACAGATGAGGAAATTGAGG - Intergenic
1202299841 Y:23400652-23400674 CTTTACAGATGAGGAAACTGAGG - Intergenic
1202377400 Y:24250136-24250158 CTTGACAGGTGGGGAAAATGGGG + Intergenic
1202493380 Y:25419985-25420007 CTTGACAGGTGGGGAAAATGGGG - Intergenic
1202570969 Y:26269946-26269968 CTTTACAGATGAGGAAACTGAGG + Intergenic