ID: 1059752418

View in Genome Browser
Species Human (GRCh38)
Location 9:117260278-117260300
Sequence TCATGTGAACAGAGGGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059752414_1059752418 22 Left 1059752414 9:117260233-117260255 CCAACTGCTATATATACTGGACT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG No data
1059752415_1059752418 -8 Left 1059752415 9:117260263-117260285 CCTTTGAGCAATCTGTCATGTGA 0: 1
1: 0
2: 1
3: 6
4: 170
Right 1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG No data
1059752412_1059752418 28 Left 1059752412 9:117260227-117260249 CCTTCACCAACTGCTATATATAC 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059752418 Original CRISPR TCATGTGAACAGAGGGCAAA AGG Intronic
No off target data available for this crispr