ID: 1059754869

View in Genome Browser
Species Human (GRCh38)
Location 9:117283173-117283195
Sequence ATAGCGAAGTAGAATGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059754869 Original CRISPR ATAGCGAAGTAGAATGAGCA TGG (reversed) Intronic
901122067 1:6904031-6904053 ATTGCTGAGTAGAGTGAGCAAGG - Intronic
901583060 1:10261882-10261904 CTAGGGAAGTAGAATGAGAGAGG - Intronic
904836802 1:33342919-33342941 ATGGCAGAGTAGAAAGAGCATGG + Intronic
906139460 1:43525236-43525258 ATCGCGAGGTAGAGGGAGCAAGG + Intronic
907645137 1:56234893-56234915 ATGGTGAAGTAAAAAGAGCACGG - Intergenic
908277037 1:62483998-62484020 ACAGCAAATTATAATGAGCAGGG - Intronic
908403488 1:63792039-63792061 AGGGCCAAGAAGAATGAGCAGGG + Intronic
916369878 1:164080250-164080272 ATACCGAAGGACAATGAGAAAGG + Intergenic
917601614 1:176579684-176579706 TTAGTGTAGTAGAAAGAGCATGG + Intronic
917657294 1:177138970-177138992 ATGGCGGAGTGGAAAGAGCATGG - Intronic
918933116 1:190882797-190882819 AAAAAGAAGTAGAAAGAGCAAGG - Intergenic
919424462 1:197412500-197412522 ATAATGAAGTAGAATAAACATGG - Intronic
919622324 1:199876758-199876780 ATCGAGAAGGAAAATGAGCAAGG + Intergenic
919766567 1:201131398-201131420 AGAGCCAAGTAGGCTGAGCATGG + Intergenic
921722568 1:218489583-218489605 ATAGTGAAGCACACTGAGCAGGG + Intergenic
1065372343 10:25000832-25000854 AAAGCAAGATAGAATGAGCAAGG - Intronic
1066530273 10:36330232-36330254 ATTACAAAGAAGAATGAGCAAGG - Intergenic
1067409469 10:46051889-46051911 AAACCGAACTAAAATGAGCATGG + Intergenic
1068036932 10:51771500-51771522 ATAGGAAATTAGAATGAACAAGG - Intronic
1070270518 10:74950059-74950081 ACAGAGAAGTATAATGAGCAGGG + Intronic
1070736008 10:78864130-78864152 ATAGCAGATTAGAAAGAGCATGG + Intergenic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1072232356 10:93424544-93424566 AAAGCCAAGTAGAATGCTCAGGG + Intronic
1075094172 10:119460367-119460389 ATAAATAAATAGAATGAGCAGGG + Intergenic
1075274775 10:121083658-121083680 ACAGCCAAGTGGCATGAGCAAGG + Intergenic
1076947011 10:133658382-133658404 ATAGCGTAGTGAGATGAGCAAGG + Intergenic
1082939385 11:58687933-58687955 ATAGAGCAGTAGAAAGAGAAGGG + Intronic
1086881095 11:92154353-92154375 ATAGGGAATTTGAATGAGAATGG - Intergenic
1092085121 12:5750710-5750732 ATAGCGAAGGAGAATGATAGAGG + Intronic
1092925232 12:13265943-13265965 ATAGCGATGTTGAATGAACAAGG - Intergenic
1094479835 12:30872864-30872886 ATAAGGTAGTAGAAAGAGCATGG - Intergenic
1095315656 12:40757934-40757956 ATAGAAAAGTAGAAATAGCATGG + Intronic
1095614708 12:44174432-44174454 ATAGTTAAGTATAGTGAGCAGGG - Intronic
1097614064 12:61862681-61862703 ATAGAGAATTAGAAATAGCAAGG - Intronic
1099621158 12:85004424-85004446 ATAGAGCATGAGAATGAGCAGGG - Intergenic
1099759741 12:86903284-86903306 ATAGCAGAGTAGAGTCAGCAAGG + Intergenic
1101395989 12:104348211-104348233 ACAGAGAAGTAGTATGATCAAGG - Intronic
1107855365 13:44610358-44610380 AAAATGAAGTAGAATGAGAATGG + Intergenic
1113777179 13:112954476-112954498 ATAGTGAAGTTAAATGAGGAGGG - Intronic
1116039953 14:39674003-39674025 ATGGAGTAGTAGGATGAGCATGG - Intergenic
1116315360 14:43382603-43382625 ATTTCGAAGTAGAATAAGAAAGG - Intergenic
1119827970 14:77673830-77673852 ATAGCGAAGTAAAACGGGCCAGG - Exonic
1120724062 14:87917704-87917726 ATAAAGAAGTATAATGAGAAAGG - Intronic
1120930056 14:89839343-89839365 AGAGCAAAGTAGAATGGGGATGG + Intronic
1122492180 14:102125477-102125499 AGAGGGAAGCAGAATGAGCTGGG + Intronic
1122987441 14:105219017-105219039 ATAGCGAAAGAGAAGGAGCTCGG - Exonic
1123841945 15:24256996-24257018 ATAACTAAGTAGAATGTGAATGG + Intergenic
1127944110 15:63732639-63732661 AGAGAGAAGAATAATGAGCAAGG - Intronic
1134354843 16:13472194-13472216 AAAGCAAATTAGAATAAGCAAGG - Intergenic
1135932172 16:26747565-26747587 AAAGAGTAGTAGAAAGAGCAGGG - Intergenic
1137903965 16:52300267-52300289 AAAGCAACCTAGAATGAGCAAGG - Intergenic
1138322309 16:56126146-56126168 ATAATGTAGTAGAATGAGTATGG - Intergenic
1139323326 16:66132963-66132985 ACAGCAAAGTAGAAGGAACATGG - Intergenic
1141741510 16:85896292-85896314 GTAGCAAAGTAGAATCAACAGGG + Intergenic
1144387709 17:14765116-14765138 ATAGAGAAGTAAAAAGAGAAAGG + Intergenic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1150946825 17:69756152-69756174 ATATCTAAGAAGATTGAGCATGG - Intergenic
1154158744 18:11964178-11964200 ATATCTCAGGAGAATGAGCAAGG - Intergenic
1156615488 18:38778725-38778747 ATTGTGAAAAAGAATGAGCATGG + Intergenic
1157652068 18:49343291-49343313 AGAGCTGAGCAGAATGAGCAAGG - Intronic
1163239491 19:16051502-16051524 ATAGCGAATTAGGATAACCACGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
925920023 2:8632046-8632068 ATATCAAAGTATAATAAGCAGGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
929983431 2:46701319-46701341 ATAGCTAAACAGAATGAGAATGG + Intronic
932929622 2:76018733-76018755 ATAACAAAGTAGAAAGAGTAAGG - Intergenic
935587967 2:104818549-104818571 AGAGCCAATTAGAAAGAGCAGGG - Intergenic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
939718299 2:145613992-145614014 AGAGTGAAAAAGAATGAGCAGGG + Intergenic
941694572 2:168537193-168537215 AAAGCAAAGTATAAAGAGCAGGG + Intronic
944278777 2:197870907-197870929 ATAGTGAATTGGAATGATCAGGG - Intronic
946137228 2:217657265-217657287 ATAGCCAAGAAGAGAGAGCAGGG + Intronic
1168873258 20:1149583-1149605 GTAGCCAAGTTGAATAAGCATGG + Intronic
1169825660 20:9765926-9765948 ATAACCAAGTAGAATGGGCTGGG + Intronic
1169852259 20:10065107-10065129 AAAGCCAAGTAGAGAGAGCAAGG - Intergenic
1170711968 20:18799349-18799371 ATAGGGAAGGAGGAGGAGCAAGG - Intergenic
1170838272 20:19903460-19903482 ATCTGGAAGTAGAATGAGAAAGG - Intronic
1173662878 20:44746151-44746173 ATGGCGAAGTAGAAGGAGCCGGG - Exonic
1175744700 20:61447606-61447628 AAAAGGAAGTAGAATGAGCAGGG - Intronic
1176700083 21:10036086-10036108 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1182033230 22:27176511-27176533 AGCGTGAAGTAGAATGAGGACGG - Intergenic
1185120260 22:48962076-48962098 TTAGCAAAGAAGAAAGAGCAGGG - Intergenic
950037077 3:9893966-9893988 ATAGAGAAGTAGACTGGGTATGG + Exonic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
952178680 3:30894771-30894793 ATAGCAAAGTGAAAGGAGCACGG - Intergenic
957389995 3:79551857-79551879 ATAGGTAAGTAAACTGAGCATGG + Intronic
957462875 3:80545119-80545141 ATAGGGAAGTAGAAAGAGAAGGG + Intergenic
957812840 3:85249267-85249289 ATAGCTAACTAAAATTAGCAAGG - Intronic
963326589 3:143869806-143869828 ATAGTGCAGTAGAATAAGAATGG - Intergenic
964090453 3:152870038-152870060 ATAGGGAAGTAGGTTGAGAAGGG - Intergenic
964353171 3:155823225-155823247 CTAGCAAGGTAGAATCAGCATGG - Exonic
966559861 3:181308184-181308206 ATAAGGAAGGAGAATGAGCTAGG + Intergenic
967669899 3:192220309-192220331 ATAGGGAAGTAGAATGGTGAAGG - Intronic
972727605 4:41759103-41759125 ATAGCACAGTAGAAAGAGAATGG - Intergenic
972842045 4:42942783-42942805 ATAAGGAAATAGAAAGAGCAAGG - Intronic
973114784 4:46442108-46442130 ATAATGAAATAGAATGAACAAGG - Intronic
975013902 4:69386927-69386949 ACATCGAAGTAGAATTAGGAAGG - Intronic
977011046 4:91633735-91633757 ATGTCGAAGTAAAATGAGAAGGG - Intergenic
977628825 4:99218799-99218821 ATAGTAAAGTAGAAAGAGAATGG - Intronic
977722350 4:100254396-100254418 AAAGGGAAGGAGCATGAGCAGGG + Intergenic
978045132 4:104115919-104115941 ATAGAGAGGTAAAATGATCAAGG - Intergenic
980372483 4:131894718-131894740 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
980909502 4:138981146-138981168 GTAGTGCAGTAGAATGATCATGG + Intergenic
981737757 4:147970795-147970817 ATAAAGATGTAGACTGAGCATGG + Intronic
983954192 4:173677734-173677756 ATATAGAAGGTGAATGAGCAAGG + Intergenic
985450469 4:190059181-190059203 ATAGCGTAGTGAGATGAGCAAGG + Intergenic
986849122 5:11790391-11790413 ATAGAGGTGTAGATTGAGCATGG + Intronic
988313652 5:29594763-29594785 ATACTAAGGTAGAATGAGCATGG + Intergenic
989991413 5:50771921-50771943 ATAGCACAGTAGAATGACTATGG - Intronic
990513468 5:56510587-56510609 AAAGGGATGCAGAATGAGCAAGG - Intergenic
993002893 5:82400011-82400033 TAAGAGAAGTAGAATGGGCAAGG - Intergenic
993874485 5:93290454-93290476 ATAGCAAAGAAAAATCAGCAGGG + Intergenic
994381506 5:99077316-99077338 ATACCAAAGAAGAATGAGAAAGG - Intergenic
995294138 5:110499135-110499157 ATAGAAAAGGAGAAAGAGCAGGG + Intronic
995529883 5:113082075-113082097 AAAGCAAAGGAGAATGACCAGGG - Intronic
998182106 5:139953045-139953067 AGAGAGAAGAAGAAAGAGCAAGG + Intronic
1001428380 5:171640195-171640217 ATAGCGAAGTCAAATGATCAGGG - Intergenic
1001778444 5:174346868-174346890 ATAGAGAAGGAGGAAGAGCATGG - Intergenic
1003718596 6:8674899-8674921 ATAGGGAAGTAAAAAGGGCAAGG + Intergenic
1010191048 6:73197051-73197073 GCAGCCAAGCAGAATGAGCAGGG + Exonic
1013673652 6:112433248-112433270 AGAGAGAAGAAGCATGAGCAAGG + Intergenic
1015023871 6:128509383-128509405 ATAATAAAGAAGAATGAGCATGG - Intronic
1015167533 6:130214770-130214792 AGAGAGAATTAGAATGAGAAGGG - Intronic
1017439323 6:154448646-154448668 ATGGCCAAGTAGTCTGAGCACGG - Intronic
1023741715 7:43287189-43287211 ATAGGGAAAGAGAGTGAGCATGG + Intronic
1027900018 7:84100973-84100995 ATGGGGAAGTAGAAATAGCAGGG - Intronic
1031445962 7:121854515-121854537 ATTGCAAAGTACAATGAGCCAGG - Intergenic
1032116497 7:129122071-129122093 ATTGGGATGTAGACTGAGCATGG - Intergenic
1034067875 7:148154052-148154074 AGAGCCAAGTAAATTGAGCACGG - Intronic
1037067739 8:14602969-14602991 ATGCCGAAGTAGAATCAGCAGGG + Intronic
1037958183 8:23074916-23074938 AGAGAGAAGGAGAATGAGAAGGG - Intergenic
1040670226 8:49680760-49680782 ATGGGGAAGTAGAATTAACAGGG + Intergenic
1046795101 8:118363159-118363181 ATAGGGGAGTGGAAAGAGCATGG + Intronic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048433382 8:134391470-134391492 ATAGGGAAGTAGATGGAGGAAGG - Intergenic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1050421116 9:5466214-5466236 ATAGGGAAGTAGAATATGGAAGG + Intronic
1050451863 9:5790108-5790130 AGAGGAAAGTAGAATAAGCATGG + Intronic
1050481453 9:6091660-6091682 ATAGTGCAGTGGTATGAGCATGG + Intergenic
1051502650 9:17794937-17794959 AGAGCGAAGTACCATGTGCAAGG + Intronic
1051649871 9:19312039-19312061 GTAGCGCTGTAAAATGAGCAAGG + Intronic
1052104425 9:24495051-24495073 TTAGGGAAAAAGAATGAGCAAGG - Intergenic
1053637223 9:40022561-40022583 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1053768804 9:41442360-41442382 CTAGCGAAGTGGAATGAGGAAGG - Intergenic
1054318058 9:63619410-63619432 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1054547471 9:66353837-66353859 CTAGCGAAGTGGAATGAGGAAGG - Intergenic
1054894542 9:70294068-70294090 AAAGCAAAGCAGAATGAGTAAGG + Intronic
1055468513 9:76589037-76589059 ATAGAGCAAAAGAATGAGCATGG + Intergenic
1055781689 9:79828064-79828086 ACAGAGGACTAGAATGAGCAGGG + Intergenic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1059336771 9:113573901-113573923 ACAGAGGAGTAGAAAGAGCAGGG + Intronic
1059653969 9:116340361-116340383 ATAGCAAAGAAAAAAGAGCAGGG + Intronic
1059754869 9:117283173-117283195 ATAGCGAAGTAGAATGAGCATGG - Intronic
1059885641 9:118741811-118741833 ATAGCGAAGTATGGTGAGAAGGG + Intergenic
1202785095 9_KI270719v1_random:6146-6168 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1187520678 X:20011264-20011286 ACAGGGAAGCAGATTGAGCAGGG + Intronic
1188948524 X:36338609-36338631 ACAGCAAAGGAGAATGAGCAGGG - Intronic
1189055384 X:37694209-37694231 AAAGGTAAGTAGGATGAGCATGG + Intronic
1193061941 X:77216025-77216047 CTAGCGAAGTAGAATGAGATTGG + Intergenic
1198759376 X:140015901-140015923 AGAGCAAAGTTGAATGAGCTGGG + Intergenic
1199113783 X:143965345-143965367 ATAGCAGAGTAGACTAAGCAGGG - Intergenic
1199506365 X:148566256-148566278 ATAGGGAAAGAGAATGAGCTTGG - Intronic