ID: 1059755451

View in Genome Browser
Species Human (GRCh38)
Location 9:117289237-117289259
Sequence GACCCAAGGCTACCACCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059755451_1059755456 -5 Left 1059755451 9:117289237-117289259 CCACACGGTGGTAGCCTTGGGTC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1059755456 9:117289255-117289277 GGGTCACTTTGGCTCATGGGTGG No data
1059755451_1059755455 -8 Left 1059755451 9:117289237-117289259 CCACACGGTGGTAGCCTTGGGTC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1059755455 9:117289252-117289274 CTTGGGTCACTTTGGCTCATGGG No data
1059755451_1059755458 -3 Left 1059755451 9:117289237-117289259 CCACACGGTGGTAGCCTTGGGTC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1059755458 9:117289257-117289279 GTCACTTTGGCTCATGGGTGGGG No data
1059755451_1059755461 9 Left 1059755451 9:117289237-117289259 CCACACGGTGGTAGCCTTGGGTC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1059755461 9:117289269-117289291 CATGGGTGGGGAGGGTCTGAAGG No data
1059755451_1059755462 10 Left 1059755451 9:117289237-117289259 CCACACGGTGGTAGCCTTGGGTC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1059755462 9:117289270-117289292 ATGGGTGGGGAGGGTCTGAAGGG No data
1059755451_1059755460 1 Left 1059755451 9:117289237-117289259 CCACACGGTGGTAGCCTTGGGTC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1059755460 9:117289261-117289283 CTTTGGCTCATGGGTGGGGAGGG No data
1059755451_1059755454 -9 Left 1059755451 9:117289237-117289259 CCACACGGTGGTAGCCTTGGGTC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1059755454 9:117289251-117289273 CCTTGGGTCACTTTGGCTCATGG No data
1059755451_1059755457 -4 Left 1059755451 9:117289237-117289259 CCACACGGTGGTAGCCTTGGGTC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1059755457 9:117289256-117289278 GGTCACTTTGGCTCATGGGTGGG No data
1059755451_1059755459 0 Left 1059755451 9:117289237-117289259 CCACACGGTGGTAGCCTTGGGTC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1059755459 9:117289260-117289282 ACTTTGGCTCATGGGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059755451 Original CRISPR GACCCAAGGCTACCACCGTG TGG (reversed) Intronic
900386813 1:2414400-2414422 GAGCCAAGGCTTGAACCGTGGGG - Intergenic
906665815 1:47621301-47621323 GAGCCAAACCTACCACCCTGTGG + Intergenic
913401196 1:118435415-118435437 AACCCAAGGCTATCACAGTGTGG - Intergenic
914384672 1:147156836-147156858 GATCCAAGGACACCACCATGTGG + Exonic
919790935 1:201290511-201290533 TACCCAAGGCCACCTCCTTGAGG - Intronic
920380892 1:205534014-205534036 GACCCCAGGCTACCCCTGGGAGG - Intergenic
1066756450 10:38717149-38717171 GAGCCAAGCATACCACAGTGGGG - Intergenic
1076810528 10:132884262-132884284 GACGCCTGGGTACCACCGTGGGG - Intronic
1077907734 11:6546996-6547018 AACCCAAGGCTGCCAGCCTGTGG + Exonic
1087874456 11:103339320-103339342 GGCCCATGGCCACCACCATGTGG + Intronic
1092211153 12:6647212-6647234 GACCCAGCGCGACCACCATGAGG + Intronic
1101179935 12:102205036-102205058 GATCCAAGGCTTCCAGCATGTGG + Intergenic
1102513814 12:113433632-113433654 GACCCAAGGCAACCACAGCAGGG - Intronic
1103628819 12:122242482-122242504 GACACAATGCTAAGACCGTGGGG - Exonic
1123440716 15:20289214-20289236 GAGCCAAGCATACCACAGTGGGG - Intergenic
1136726138 16:32359176-32359198 GAGCCAAGCATACCACAGTGGGG + Intergenic
1136844470 16:33565221-33565243 GAGCCAAGCATACCACAGTGGGG + Intergenic
1203000293 16_KI270728v1_random:158580-158602 GAGCCAAGCATACCACAGTGGGG - Intergenic
1203131895 16_KI270728v1_random:1694983-1695005 GAGCCAAGCATACCACAGTGGGG - Intergenic
1203154637 16_KI270728v1_random:1865520-1865542 GAGCCAAGCATACCACAGTGGGG + Intergenic
1143948750 17:10616695-10616717 GAGCCAAGGCTGCCACCTAGAGG - Intergenic
1147679334 17:42230344-42230366 GACCCATGGCTAAGACGGTGAGG + Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1151408058 17:73902275-73902297 GAACCCAGGCCACCACCGGGCGG - Intergenic
1152805809 17:82355536-82355558 CACCCCTGGCCACCACCGTGTGG + Intergenic
1155942836 18:31816859-31816881 GACACATGGCTTCCACCTTGTGG + Intergenic
1157431815 18:47634487-47634509 GACCCAAGGCCAGCACCTTTGGG - Intergenic
1160225008 18:77005712-77005734 GACCCAAAGCTACAGCCTTGAGG + Intronic
1162966345 19:14157959-14157981 GACCCAAGGCTGCCGCCTGGTGG - Exonic
934319749 2:91961405-91961427 GAGCCAAGCATACCACAGTGGGG - Intergenic
935736627 2:106111568-106111590 AAACCCAGGCTACCACTGTGTGG + Intronic
935953048 2:108348344-108348366 TTCCCAATGCTACCACCCTGTGG + Intergenic
937589536 2:123596437-123596459 TACCCAAGGCTACAACAGTCAGG + Intergenic
937907103 2:127057786-127057808 GACCCCAGGCCACCCCCGAGAGG + Intronic
946226039 2:218264645-218264667 GACCCAAGCCCACCACCTAGGGG + Intronic
1172061210 20:32188620-32188642 GACCACAGGCTACCACCAAGTGG - Intergenic
1172222410 20:33283062-33283084 GTCCCAAGGCTGCCTCCGGGCGG + Intronic
1175579301 20:60086801-60086823 GAGCAAAGGCACCCACCGTGAGG - Intergenic
1176895313 21:14370520-14370542 GACCCAATGATCCCACCTTGTGG - Intergenic
1179638672 21:42732256-42732278 CACAGAAGGCTTCCACCGTGCGG - Intronic
1180307999 22:11145449-11145471 GAGCCAAGCATACCACAGTGGGG - Intergenic
1180546475 22:16507262-16507284 GAGCCAAGCATACCACAGTGGGG - Intergenic
1182212714 22:28690117-28690139 GAGCCAAGCATACCACAGTGGGG + Intronic
954136600 3:48584838-48584860 CACCCCAGGCTCCCACCCTGTGG + Intronic
964480038 3:157130788-157130810 GACCCCATGCTACCCCCTTGTGG + Intergenic
983012449 4:162564353-162564375 GACCCAGGGCTTCTACCTTGAGG + Intergenic
987043542 5:14085433-14085455 GTGCCAAGGCTTCCACCGGGAGG - Intergenic
999553909 5:152720517-152720539 CCCCCAAGGCTGCCACAGTGAGG - Intergenic
1002424261 5:179166344-179166366 GACCCAGGGATCCCACCATGAGG + Intronic
1005865643 6:29934024-29934046 GACCCAGTGATTCCACCGTGGGG - Intergenic
1015500225 6:133924121-133924143 GAGACAAGGCTGCCACCATGTGG - Intergenic
1017710016 6:157159071-157159093 GACCCACTGCTACCCCCCTGTGG + Intronic
1030677091 7:112395265-112395287 AACCCAAGTCTCCCACAGTGTGG - Intergenic
1031303221 7:120090117-120090139 GACTCAAGGCTGACACCCTGCGG + Intergenic
1035299276 7:157886855-157886877 GAGCCAAGCCCACCACGGTGGGG + Intronic
1051455059 9:17246526-17246548 GGCCCATGGATACCACTGTGTGG + Intronic
1057938528 9:99260406-99260428 AACCCAGGGCTACCATAGTGTGG - Intergenic
1059755451 9:117289237-117289259 GACCCAAGGCTACCACCGTGTGG - Intronic
1060941650 9:127546063-127546085 CACCCAAGGCTGCCATCCTGCGG + Intronic
1187742386 X:22370113-22370135 TACCCAAGGGTACCACTGTAAGG + Intergenic
1199182347 X:144873237-144873259 GAAGCATGGCTACAACCGTGAGG - Intergenic
1201650300 Y:16277261-16277283 GAACAAAGGCTTCCACAGTGTGG - Intergenic