ID: 1059757474

View in Genome Browser
Species Human (GRCh38)
Location 9:117307097-117307119
Sequence CCCCTGTGAAAATGTTCAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059757471_1059757474 -1 Left 1059757471 9:117307075-117307097 CCATGTTTATACAACCTAAAAAC 0: 1
1: 0
2: 2
3: 23
4: 276
Right 1059757474 9:117307097-117307119 CCCCTGTGAAAATGTTCAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059757474 Original CRISPR CCCCTGTGAAAATGTTCAAC CGG Intronic
No off target data available for this crispr