ID: 1059760608

View in Genome Browser
Species Human (GRCh38)
Location 9:117333930-117333952
Sequence TCTTGTCCAGATTAATGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059760604_1059760608 10 Left 1059760604 9:117333897-117333919 CCTGTGTTTCACTGCTTCCATGT 0: 1
1: 0
2: 0
3: 18
4: 198
Right 1059760608 9:117333930-117333952 TCTTGTCCAGATTAATGGCCTGG No data
1059760605_1059760608 -7 Left 1059760605 9:117333914-117333936 CCATGTTGTGCACTCCTCTTGTC 0: 1
1: 0
2: 1
3: 14
4: 146
Right 1059760608 9:117333930-117333952 TCTTGTCCAGATTAATGGCCTGG No data
1059760603_1059760608 16 Left 1059760603 9:117333891-117333913 CCAGGGCCTGTGTTTCACTGCTT 0: 1
1: 0
2: 2
3: 37
4: 281
Right 1059760608 9:117333930-117333952 TCTTGTCCAGATTAATGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059760608 Original CRISPR TCTTGTCCAGATTAATGGCC TGG Intronic
No off target data available for this crispr