ID: 1059761331

View in Genome Browser
Species Human (GRCh38)
Location 9:117340444-117340466
Sequence AAAATTTAGCAGGGTGCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059761331_1059761336 5 Left 1059761331 9:117340444-117340466 CCCGGTGCACCCTGCTAAATTTT 0: 1
1: 0
2: 2
3: 23
4: 193
Right 1059761336 9:117340472-117340494 CACCTCTAAAGAATACATCAAGG No data
1059761331_1059761337 6 Left 1059761331 9:117340444-117340466 CCCGGTGCACCCTGCTAAATTTT 0: 1
1: 0
2: 2
3: 23
4: 193
Right 1059761337 9:117340473-117340495 ACCTCTAAAGAATACATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059761331 Original CRISPR AAAATTTAGCAGGGTGCACC GGG (reversed) Intronic
901087322 1:6619244-6619266 AAAATTCATCAGTGTGCAACAGG - Intronic
901235789 1:7667038-7667060 AAAAATTAGCTGGATGCAGCAGG - Intronic
901566326 1:10118797-10118819 AAAAATTAGCTGGGTGTGCCGGG - Intronic
902476205 1:16689507-16689529 AAAAATTAGCTGGGTGGGCCGGG - Intergenic
903822846 1:26116261-26116283 ACAATTTAGGAGGGTGAAGCAGG + Intronic
905214968 1:36400510-36400532 AAAATTTAGCTGGGTGTAATGGG + Intergenic
908236101 1:62148659-62148681 ACAATAAAGCAGCGTGCACCTGG - Intronic
908383616 1:63619654-63619676 AAAGTTTAGCACGGTTCACAAGG + Intronic
909152878 1:72031100-72031122 AAAATATAGCAGCCTGCAGCTGG + Intronic
910831028 1:91462921-91462943 AAAATTTAGAGCAGTGCACCTGG - Intergenic
912561222 1:110553029-110553051 AAAGTTTAGCAGGGAGAACAGGG + Intergenic
913182604 1:116336750-116336772 AAAATTCAGAAGTGAGCACCAGG + Intergenic
915037962 1:152944316-152944338 AAAAATTAGCCGGGTGTGCCAGG + Intergenic
915082876 1:153364009-153364031 AAAATTCCGCAGGGTGCAAGTGG - Intergenic
917430905 1:174967633-174967655 AAAAATTAGCTGGGTACAGCTGG - Intronic
918784597 1:188749666-188749688 AAGATTTAGAAGCTTGCACCTGG + Intergenic
922117915 1:222632323-222632345 AAAAATTAGCAGGCTTTACCTGG - Exonic
923997944 1:239517790-239517812 AAAATTCAGTATGGTGAACCGGG + Intronic
1065294893 10:24265007-24265029 AAAATTTAGCAGGGTGTGGTGGG - Intronic
1065918316 10:30370236-30370258 AAAATTCAGCAGAGAGCAACAGG - Intronic
1067220411 10:44340093-44340115 AAAATGTGGCAGGGTGGACGGGG - Intergenic
1070141166 10:73739298-73739320 AAAATTTAGCTGGGTGGGCATGG - Intergenic
1072428952 10:95354445-95354467 CAAATTGAGAAGGGTGCAACAGG - Intronic
1074382757 10:112993590-112993612 AAGATTCCTCAGGGTGCACCTGG + Intronic
1076447161 10:130524576-130524598 CAAACTTAGCAAGGTGCACAGGG - Intergenic
1077581521 11:3420399-3420421 CAGATGTCGCAGGGTGCACCTGG + Intergenic
1083439031 11:62663919-62663941 AAAAATTAGCCGGGTGCAGTGGG + Intronic
1084113227 11:67026765-67026787 AAAATTTAGCTGGGTGCAGTGGG - Intronic
1084238434 11:67803217-67803239 CAGATGTTGCAGGGTGCACCTGG + Intergenic
1084575039 11:69983559-69983581 GAAAATAAGCAGGGTGCTCCGGG + Intergenic
1084829677 11:71759374-71759396 AAAAATTAGCTGGGTGCGGCCGG - Intergenic
1084833975 11:71789608-71789630 CAGATGTCGCAGGGTGCACCTGG - Intronic
1084923816 11:72495530-72495552 AAAAATTAGCCGGGTGCAGTGGG - Intergenic
1087591048 11:100188290-100188312 AAAAATTAGCCGGGTGTAGCGGG + Intronic
1089455525 11:118623416-118623438 AAAATGTAGCCAGGGGCACCTGG - Intronic
1090732856 11:129586807-129586829 ATTATTTAGCAGGGTGCCCCTGG + Intergenic
1092082974 12:5733396-5733418 AAAATTTAACTGTGTACACCTGG + Intronic
1092409126 12:8240858-8240880 CAGATGTCGCAGGGTGCACCTGG + Intergenic
1092413563 12:8272302-8272324 AAAAATTAGCTGGGTGCGGCCGG + Intergenic
1095091854 12:38114901-38114923 AAAATTTTGCATAGTGCACCAGG + Intergenic
1096442458 12:51655522-51655544 AAAATTTATCTGGGTCCCCCTGG - Intronic
1096508335 12:52111595-52111617 AAAATATCACAGGGTGTACCTGG + Intergenic
1096698744 12:53368195-53368217 AAAAATTAGCCGAGTGCAGCCGG + Intergenic
1097284048 12:57864272-57864294 ACAATTTGGCAGTGTGCACAGGG - Intergenic
1100085272 12:90902735-90902757 AAAATTTTGAATGGTGCACCTGG - Intergenic
1101021469 12:100558508-100558530 AAAAGTTAGCTGGGTGCAGTGGG - Intronic
1102894851 12:116590715-116590737 ACAACTTAGCAGGGTGCTACTGG - Intergenic
1103372233 12:120428259-120428281 AAAAATTAGCTGGGTGTGCCGGG - Intergenic
1103848095 12:123913572-123913594 ACCATTTAGCAGGGTGCTCTAGG + Intronic
1104652217 12:130543732-130543754 AAAATTAAGTTGGGTGCACCAGG + Intronic
1105610988 13:21969697-21969719 ATAATTTAGAAGGGTGCACTAGG - Intergenic
1107681187 13:42852968-42852990 ATTATATAGCAGGGTGCATCTGG + Intergenic
1108296755 13:49028390-49028412 AAAAATTAGCTGGGTGTAACTGG - Intronic
1109946597 13:69442398-69442420 GAAATGTAGCATGGTGCATCTGG - Intergenic
1111027229 13:82544870-82544892 AAAATTTCGCAGGTTGCAAATGG - Intergenic
1111624458 13:90766266-90766288 AAAATTTATAAGGGTGAACATGG + Intergenic
1112703443 13:102038431-102038453 AACATTTTCCAGGGAGCACCCGG + Intronic
1112830327 13:103441523-103441545 AAGATTTAGGAGGGTACACAGGG + Intergenic
1114478331 14:23013849-23013871 AAAATTTAGCCGGGTGTAGTGGG + Intergenic
1116029999 14:39560123-39560145 AAAATTTAACAGAGAGAACCAGG - Intergenic
1118106858 14:62669565-62669587 AAAAGTTAGAAGGGTTCTCCTGG + Intergenic
1119309865 14:73636730-73636752 AAAAATTAGCAGGGTGCAGTGGG + Intergenic
1119355310 14:74001204-74001226 AAAAATTAGCAGGGTGTGTCTGG + Intronic
1120063693 14:80014914-80014936 AAAATGAAGCAGGGTGCTACTGG + Intergenic
1120929230 14:89831628-89831650 ATAATTTAGCAGTGTTTACCTGG + Intronic
1124851299 15:33341188-33341210 AAAAATTAGCTGGGTGCAGTGGG - Intronic
1125935792 15:43634502-43634524 AAAATTTAGCAGGGTGGGTGCGG - Intronic
1125948558 15:43730959-43730981 AAAATTTAGCAGGGTGGGCATGG - Intergenic
1130434063 15:83878899-83878921 AATGTTTGGCAGTGTGCACCAGG + Intronic
1132526629 16:419355-419377 AAAAATTAGCTGGGTGCAGCTGG - Intergenic
1133350091 16:5095667-5095689 CAGATGTCGCAGGGTGCACCTGG + Intronic
1133781821 16:8944954-8944976 AAAAATTAGCTGGGTGGACCGGG + Intronic
1134480877 16:14618190-14618212 AAAAATTAGCCGGGTGTGCCAGG + Intronic
1137458877 16:48639808-48639830 AAAAATTAGTTGGGTGGACCAGG + Intergenic
1138709643 16:58955827-58955849 AAAATTTAGAAGAATTCACCAGG + Intergenic
1138908849 16:61371823-61371845 CAAAATTAGAAGGGTGAACCAGG - Intergenic
1140468377 16:75200275-75200297 AAAAAGTAGCTGGGTGCAGCGGG - Intergenic
1140849685 16:78923416-78923438 AAAAAATAGCAGGCTGGACCTGG - Intronic
1143642688 17:8208128-8208150 AAAAATTAGCTGGGTGCGGCTGG + Intronic
1144082882 17:11780761-11780783 AAAACTTAGCACAGTGCACGTGG + Intronic
1145102036 17:20085487-20085509 ATAATTTTGCAGGCTGCTCCTGG - Intronic
1146793042 17:35763743-35763765 AAAAATTAGCAGGGCGCAGCGGG + Intronic
1146804169 17:35851983-35852005 AAAAATTAGCTGGGTGCAGTGGG - Intronic
1149013962 17:51886909-51886931 AGAATGGAGCAGGGTGCACACGG - Intronic
1149013970 17:51886958-51886980 AGAATAGAGCAGGGTGCACAGGG - Intronic
1149767024 17:59287758-59287780 AAAATATAACAGGATGCACCTGG + Intergenic
1150046041 17:61914402-61914424 AAAAATTAGCTGGGCGCGCCAGG + Intronic
1153181842 18:2444243-2444265 CAAATTTATCAGTGTGCACAGGG + Intergenic
1153247119 18:3083008-3083030 GAAATGAAGCAGTGTGCACCAGG - Intronic
1154426807 18:14278408-14278430 AAAATTTGGCTGTGTGCCCCTGG + Intergenic
1158604608 18:58884226-58884248 AAAAATTAGCTGGGTGCGCTGGG + Intronic
1158719409 18:59910709-59910731 AAAAATTAGCTGGGTGTGCCGGG - Intergenic
1161446022 19:4319645-4319667 TAAATTTTCCTGGGTGCACCTGG + Intronic
1162107223 19:8377343-8377365 AAAAATTAGCTGGGTGCAGTGGG - Intronic
1162407669 19:10485335-10485357 TAAATTTACCAGGCTGCACGTGG + Intergenic
1162768592 19:12935422-12935444 AAAAATTAGCTGGGTGCAGTGGG + Intergenic
1162864715 19:13536778-13536800 CAAATTTCACAGGGAGCACCGGG - Intronic
1162999889 19:14360333-14360355 AAAATCTAGCAGGGTGGGCCGGG + Intergenic
1163392802 19:17040661-17040683 AAAAATTAGCTGGGTGGGCCAGG - Intergenic
1163772827 19:19201093-19201115 AAAAATTAGCCAGGTGCAGCCGG - Intronic
1164729090 19:30488368-30488390 ACAAAGTAGCAGGGTGCAACGGG - Intronic
1166549174 19:43653827-43653849 AAAATTTAGCTGGGTGCGGCCGG + Intronic
1167060109 19:47139335-47139357 AAAAATTAGCTGGGTGTGCCAGG - Intronic
1167485286 19:49759172-49759194 AAAAATTAGCTGGGTGAAGCCGG + Intronic
1202710224 1_KI270714v1_random:15347-15369 AAAAATTAGCTGGGTGGGCCGGG - Intergenic
928604994 2:32937333-32937355 AAAAGTTAGCCGGGTGTACTGGG - Intergenic
934018904 2:87922824-87922846 ATAAGATAGCAGGGTGCATCTGG + Intergenic
934725790 2:96617699-96617721 AAAATTTAGCTGGGTGTGGCAGG + Intronic
936801170 2:116268511-116268533 AAGATTTAGAAGCTTGCACCTGG + Intergenic
937523939 2:122744270-122744292 AATAATTAGCAGCCTGCACCTGG - Intergenic
941405631 2:165084076-165084098 AAAGTTTAACAGAGTGAACCAGG - Intergenic
941909830 2:170754074-170754096 AAATTTTAGCAGATTGCATCTGG + Intergenic
943936652 2:193926660-193926682 GAAATTTAGGAGGTTGCACTGGG + Intergenic
945957187 2:216097397-216097419 AAAAATTAGCAGGGTGTGCTGGG + Intronic
946198390 2:218053792-218053814 AAAAATTAGCCGGGTGCGGCTGG - Intronic
948006275 2:234610392-234610414 AAAGTTTAGCAGGGGCCTCCTGG - Intergenic
948562401 2:238863396-238863418 ATAATTCAGAAGGATGCACCCGG + Intronic
1168988606 20:2073690-2073712 AGAATTCAGCAGAGTGCATCTGG - Intergenic
1171362922 20:24602630-24602652 ATAATTCAGAAGGGTGGACCAGG - Intronic
1171938965 20:31305672-31305694 AAAATATAGCATGGTGCAGAGGG - Intronic
1174018741 20:47511703-47511725 AAAAATTAGCTGGGTCCACGTGG - Intronic
1174803336 20:53583790-53583812 AAAATATATCAGGGTTCCCCTGG - Intronic
1177633911 21:23761900-23761922 AAAAGTTATCAGGATGCACTGGG - Intergenic
1180561334 22:16616839-16616861 AAAATATATCAGGGTTCCCCTGG + Intergenic
1182014651 22:27029680-27029702 GAAATTTTGCTGGGTGCCCCTGG + Intergenic
1183422662 22:37721163-37721185 AAAAATTAGCTGGATGCAGCCGG - Intronic
1185327144 22:50232067-50232089 AAAAATTAGCTGGGTGGGCCGGG + Intronic
954821779 3:53335948-53335970 AAAAATTAGCCGGGTGGACCTGG - Intronic
955784163 3:62518697-62518719 ACAATTTAGCAATGTGGACCAGG - Intronic
957000206 3:74875955-74875977 AAGATTGAGAAGGCTGCACCAGG + Intergenic
959337828 3:105088614-105088636 AAAATTTAGAAGTCTGCAGCTGG - Intergenic
959446269 3:106443726-106443748 AAAGATTAGTAGGGTGCACCAGG + Intergenic
960695962 3:120396573-120396595 AGAACTTAGCAGGGTGTCCCCGG - Exonic
961888054 3:130109389-130109411 CAGATGTCGCAGGGTGCACCTGG + Intronic
961891116 3:130130953-130130975 AAAAATTAGCTGGGTGCGGCCGG + Intergenic
962701067 3:138000198-138000220 AAAATATAAAAGAGTGCACCAGG + Intronic
965836150 3:172855196-172855218 AAATATTAGCAAGGTGCCCCTGG - Intergenic
966535424 3:181027873-181027895 AAAAATTAGCTGGGTGCAGTGGG + Intergenic
968786793 4:2628036-2628058 AAAAATTAGCTGGGCGCAGCCGG - Intronic
969002504 4:3993377-3993399 AAAAATTAGCTGGGTGCGGCTGG + Intergenic
969394869 4:6913982-6914004 AAAAATTAGCTGGGTGGACGTGG + Intronic
969751508 4:9115141-9115163 AAAAATTAGCTGGGTGCGGCCGG - Intergenic
969811425 4:9651441-9651463 AAAAATTAGCTGGGTGCGGCCGG - Intergenic
970647710 4:18141954-18141976 AAAATTTAGAAGGTTGGACTTGG - Intergenic
972403523 4:38726253-38726275 CAAATTTAGCACTGTCCACCTGG - Intergenic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
974640006 4:64616710-64616732 AAAAATTAGCCAGGTGTACCTGG - Intergenic
975121693 4:70735688-70735710 AAAAATTAGCTGGGTGCTGCTGG + Intronic
976094591 4:81494858-81494880 AAAAATTAGCCGGGTGTAGCCGG - Intronic
980809427 4:137855699-137855721 AAAATTTAACAGGGTCAACGTGG + Intergenic
981764608 4:148234289-148234311 AAAATTTATCAGTGCGCATCAGG + Intronic
982969284 4:161961256-161961278 AAAACTTAGCAAGGTGCAGTGGG - Intronic
983384737 4:167046058-167046080 AAAATTTAACAGGGTACATCAGG + Intronic
984451011 4:179901340-179901362 AAAATTGAGCAGGAGGCACAGGG + Intergenic
984790981 4:183614838-183614860 AAAAATAAGCAATGTGCACCCGG + Intergenic
985631674 5:1017295-1017317 ACAGTTGAGCTGGGTGCACCTGG - Intronic
986237794 5:5928017-5928039 AAAATTTAGAAGGCTGTAACCGG + Intergenic
986700331 5:10401155-10401177 TAAATTCAGCAGGGGGCACCTGG - Intronic
987869165 5:23590754-23590776 AAAATGTATCATGTTGCACCGGG + Intergenic
990773362 5:59276563-59276585 AAAATTCAGCAGAGTGTAACAGG + Intronic
990866187 5:60382856-60382878 GAAGTGTAGCAGGGTGCAACTGG - Intronic
990955513 5:61334383-61334405 AAATTGTAGCATGGTGAACCCGG + Intronic
994184256 5:96801024-96801046 AAAATTGAGCATGAAGCACCAGG + Intronic
994187396 5:96830402-96830424 AAACTGTAGCATGGTGCACCAGG + Intronic
995140799 5:108732880-108732902 AAAAATTAGCAGGGTGTGCTGGG - Intergenic
1000810291 5:165853312-165853334 AAAACTTAGCCGGGTGACCCAGG + Intergenic
1003378065 6:5597356-5597378 AAAATGTGGCACTGTGCACCAGG - Intronic
1004659601 6:17698440-17698462 AAAAATTAGCTGGGAGCAGCCGG + Intronic
1005171175 6:22986854-22986876 AAGATCTAGCTGGGTGCAGCTGG - Intergenic
1006032618 6:31188367-31188389 AAAAATTAGCAGGGCACACCGGG - Intergenic
1009694952 6:67090300-67090322 AAAATGTATCACGGTGGACCAGG - Intergenic
1010761219 6:79725428-79725450 AAAATTTAGCAGTTTGGGCCAGG + Intergenic
1012113263 6:95262166-95262188 CAAATTTGGCAGGGCGCATCTGG - Intergenic
1013234209 6:108182850-108182872 AAAAATTAGCTGGGTGTGCCGGG - Intronic
1015384528 6:132606901-132606923 AACATTTGGCTGGGTGCACTGGG + Intergenic
1018945972 6:168346712-168346734 AAAACTGAGCAGGGTGCAGAAGG - Intergenic
1020930666 7:14389332-14389354 GAAAGTCAGCAGGGTGCATCTGG + Intronic
1020941335 7:14542300-14542322 AAAAAGCAGCAGGGAGCACCTGG - Intronic
1021724075 7:23532755-23532777 AAAAATTAGCCGGGTGGGCCGGG - Intergenic
1023522516 7:41062370-41062392 AAAAATTAGCCCGGTGCAGCCGG - Intergenic
1026114502 7:67484781-67484803 GAAAAGTAGCAGGGTGCAGCGGG + Intergenic
1029081789 7:97980490-97980512 AAAAATTAGCTGGGTGCAGTTGG + Intergenic
1030067402 7:105670808-105670830 AAAAATTAGCCGGGTGTAGCCGG + Intronic
1031671569 7:124553637-124553659 AAAATTGAGCAGTGTGCAGAGGG - Intergenic
1033264002 7:139868947-139868969 AAAAATTAGCCGGGTGAGCCTGG - Intronic
1036374720 8:8190566-8190588 AAAAATTAGCTGGGTGCGGCCGG - Intergenic
1036380047 8:8230668-8230690 CAGATGTCGCAGGGTGCACCTGG - Intergenic
1036849512 8:12191994-12192016 CAGATGTCGCAGGGTGCACCTGG + Intronic
1036854822 8:12232585-12232607 AAAAATTAGCTGGGTGCGGCCGG + Intergenic
1036870874 8:12434267-12434289 CAGATGTCGCAGGGTGCACCTGG + Intronic
1036876180 8:12475078-12475100 AAAAATTAGCTGGGTGCGGCCGG + Intergenic
1038763310 8:30404905-30404927 AAAAATTAGCAGGGTGAACCAGG - Intronic
1042224480 8:66504817-66504839 AAAATGGAGCAGGGGGCACGGGG - Intronic
1042282260 8:67066905-67066927 AAAAATTAGCTGGGTGTAGCAGG - Intronic
1043261976 8:78212345-78212367 AAAATCTACCAGGGTGCAGAAGG + Intergenic
1044108222 8:88238359-88238381 AAAAATTAGCCGGGTGCAGCCGG + Intronic
1044108248 8:88238504-88238526 AAAAATTAGCTGGATGCAGCTGG + Intronic
1046875086 8:119246028-119246050 AAAAATTAGCTGGGTGCATGTGG + Intergenic
1048539151 8:135326644-135326666 AAAATTCAGGAGGGTGCATCTGG + Intergenic
1048886701 8:138914812-138914834 AAAAAGTAGAAGGGTGCCCCGGG - Intergenic
1049672544 8:143876371-143876393 CAAGTTTTGCAGGGTGGACCTGG - Intronic
1052261217 9:26518599-26518621 AAAATTTAGCAGGGCAAACGTGG - Intergenic
1052379382 9:27753552-27753574 AAAATTTAAGAGTGTGCACTGGG - Intergenic
1052810090 9:33050672-33050694 AAAAATTAGCAGGGTGCAGTGGG + Intronic
1053394898 9:37764570-37764592 AAAAATTAGCTGGGTGTGCCAGG - Intronic
1055000131 9:71439588-71439610 AAAATTTTGCATGGGGCAGCAGG - Intronic
1055461078 9:76520779-76520801 AAAATCTATGAGGGTGAACCAGG + Intergenic
1058082184 9:100712233-100712255 AAAAGTTTGCACTGTGCACCTGG - Intergenic
1058512418 9:105734209-105734231 AAAATTAAACAGGATGCTCCTGG - Intronic
1059761331 9:117340444-117340466 AAAATTTAGCAGGGTGCACCGGG - Intronic
1061038579 9:128127025-128127047 AAAAATTAGCAGGGCGCAGTGGG + Intronic
1061944243 9:133899724-133899746 AAAAATTAGCTGGGTGTGCCGGG + Intronic
1186816573 X:13243638-13243660 CAAATTTATCAGTGTGCACATGG + Intergenic
1188162343 X:26819424-26819446 AAACTTTAGCAGTGTCCACGTGG + Intergenic
1188256201 X:27964549-27964571 AAACTGTGGCAGGGTTCACCTGG + Intergenic
1189015892 X:37096144-37096166 AAAAATTAGCAGGGTGAACCAGG - Intergenic
1196028076 X:111063677-111063699 AAAAATTAGCTGGGTGCAGTGGG + Intronic
1199125624 X:144116316-144116338 ATAAGATAGCAGGGTGCATCTGG - Intergenic
1201055753 Y:9988931-9988953 ATAATTTAGCAGAATGCACTTGG + Intergenic