ID: 1059763086

View in Genome Browser
Species Human (GRCh38)
Location 9:117357853-117357875
Sequence GTTCATCCCTCCAAAGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059763086_1059763090 3 Left 1059763086 9:117357853-117357875 CCTAACCCTTTGGAGGGATGAAC 0: 1
1: 0
2: 0
3: 9
4: 187
Right 1059763090 9:117357879-117357901 GTACCTGAATGGTGATAAGAAGG No data
1059763086_1059763089 -8 Left 1059763086 9:117357853-117357875 CCTAACCCTTTGGAGGGATGAAC 0: 1
1: 0
2: 0
3: 9
4: 187
Right 1059763089 9:117357868-117357890 GGATGAACAGAGTACCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059763086 Original CRISPR GTTCATCCCTCCAAAGGGTT AGG (reversed) Intronic
901461778 1:9396312-9396334 CCTCATCCTTCCAAAGTGTTGGG - Intergenic
903917866 1:26777622-26777644 CTTCAACCTTCCAAAGTGTTGGG + Intronic
905993558 1:42361086-42361108 CTTCATCCTTCCAAAGTGCTGGG - Intergenic
906302776 1:44695687-44695709 CTTCAGCCTTCCAAAGTGTTGGG - Intronic
907209145 1:52803987-52804009 CCTCATCCTTCCAAAGTGTTGGG - Intronic
908112840 1:60914316-60914338 CTTCATCCTCCCAAAGTGTTCGG + Intronic
908145368 1:61235563-61235585 CTTCAGCCTTCCAAAGTGTTGGG - Intronic
915372690 1:155364687-155364709 CTTCAGCCTTCCAAAGTGTTGGG - Intronic
919827122 1:201511211-201511233 CCTCAGCCTTCCAAAGGGTTGGG - Intergenic
921654369 1:217717357-217717379 TTTCAGCCTTCCAAAGTGTTAGG - Intronic
922378534 1:224996409-224996431 CTTCAGCCTTCCAAAGTGTTGGG + Intronic
922850918 1:228733555-228733577 CTTCAGCCCCCCAAAGTGTTGGG + Intergenic
922878252 1:228958244-228958266 GTACATCCCAGCAAGGGGTTTGG - Intergenic
924867485 1:248000998-248001020 GTTCATCCCTCAAAAATTTTTGG - Intronic
924871381 1:248049803-248049825 GTTCATCCCTCAAAATTTTTTGG - Intronic
1064685749 10:17859566-17859588 CTTCGTCCTTCCAAAGTGTTGGG + Intronic
1065009905 10:21411593-21411615 TTTCTTCCCTGCAAAGGATTTGG + Intergenic
1065031416 10:21590189-21590211 CCTCATCCTTCCAAAGTGTTGGG + Intronic
1068578314 10:58709471-58709493 GGTCAGCTCTCCAAAGGGTAAGG + Intronic
1069053461 10:63818750-63818772 GTTCTTCTCTACAAAGGGTTAGG - Intergenic
1069129810 10:64684822-64684844 CTTCAGCCTCCCAAAGGGTTGGG + Intergenic
1074656056 10:115588541-115588563 GTTGTTCCTCCCAAAGGGTTTGG - Intronic
1077032598 11:476233-476255 GGTCTTGCCTCCAAGGGGTTTGG + Intronic
1078141682 11:8697876-8697898 GCTCAGCCTTCCAAAGTGTTGGG - Intronic
1078451286 11:11442827-11442849 GTCCCTCCCTCCCAGGGGTTAGG - Intronic
1081844297 11:46228025-46228047 CTTCATCCTCCCAAAGTGTTGGG - Intergenic
1084496784 11:69509830-69509852 GCTCTTCCCTCCTAAGGATTTGG + Intergenic
1086008648 11:82071127-82071149 CTTCAGCCCTCCAAAGTGCTGGG + Intergenic
1088017465 11:105078126-105078148 CTTCACCCCTCCAAAGTGCTGGG + Intronic
1090063452 11:123483635-123483657 CTTCAGCCCTGCAAAGTGTTGGG + Intergenic
1090369970 11:126243346-126243368 CCTCATCCTTCCAAAGCGTTGGG - Intronic
1091482493 12:848053-848075 CTTCGGCCCTCCAAAGTGTTGGG + Intronic
1096265925 12:50122602-50122624 CCTCATCCTTCCAAAGTGTTGGG - Intergenic
1096805235 12:54136685-54136707 GTTCATTCTTCCAGAGGATTTGG - Intergenic
1097522538 12:60687685-60687707 CCTCATCCTTCCAAAGTGTTGGG - Intergenic
1097682652 12:62663435-62663457 CTTCAGCCTCCCAAAGGGTTAGG + Intronic
1100473007 12:94910483-94910505 CTTCAGCCTTCCAAAGTGTTGGG - Intronic
1103478554 12:121236055-121236077 GTTCCTCCCTCCAAAGGATGCGG + Intergenic
1103961308 12:124610768-124610790 GTGCATCCCTCCAAAGGTCACGG - Intergenic
1110322813 13:74179143-74179165 GCTCCTCCTGCCAAAGGGTTTGG + Intergenic
1112452095 13:99521955-99521977 CCTCAGCCTTCCAAAGGGTTGGG + Intronic
1113645058 13:111988856-111988878 CTTCAGCCTTCCAAAGTGTTAGG + Intergenic
1115224088 14:31085521-31085543 CTTCAGCCCTCCAAAGTGCTGGG - Exonic
1115660603 14:35490504-35490526 TTTCAGCCTTCCAAAGTGTTGGG + Intergenic
1115732428 14:36285708-36285730 GTATCTCCCTCCAAAGAGTTTGG + Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1122190023 14:100034497-100034519 CTTCAACCTTCCAAAGTGTTGGG - Intronic
1123106887 14:105845944-105845966 GGTCTTCCCTCCAGAGGCTTTGG + Intergenic
1124054947 15:26233685-26233707 CTTCATCCTCCCAAAGTGTTAGG + Intergenic
1127978477 15:64016541-64016563 CTTCAGCCTTCCAAAGTGTTTGG - Intronic
1129755139 15:78093546-78093568 CTTCATGCCTCCAAAGTATTTGG + Intronic
1132418679 15:101644578-101644600 GTTCTTCCCACCAAAGGGAAGGG - Intronic
1134297661 16:12961229-12961251 GTCCATCCCTCCAAAGCCCTAGG - Intronic
1135953552 16:26937228-26937250 GCTCAGCCCTCCAAAGTGCTGGG + Intergenic
1135975097 16:27103499-27103521 CTTCAGCCTCCCAAAGGGTTGGG - Intergenic
1137714411 16:50589585-50589607 GTTCATCCCTCCAGAGGTGGTGG + Intronic
1140058329 16:71545258-71545280 CTTCAGCCCTCCAAAGTGCTGGG + Intronic
1140153641 16:72399604-72399626 CTTCGTCCCTCCAAAGTGCTGGG - Intergenic
1140217244 16:73018355-73018377 GTTCAGCCTCCCAAAGTGTTGGG - Intronic
1140955439 16:79860579-79860601 TTTCATCCCACCCAAGGGCTAGG + Intergenic
1141072467 16:80970098-80970120 CTTCATCCCTCCCAATGGTCAGG - Exonic
1142654137 17:1379232-1379254 CTTCATCCTCCCAAAGTGTTGGG - Intronic
1143719668 17:8800687-8800709 TAGCATCCTTCCAAAGGGTTTGG - Intergenic
1143798238 17:9355900-9355922 CTTCAGCCCTCCAAAGTGCTGGG + Intronic
1144829306 17:18122567-18122589 GTTCAACCCTCCAGAGGTTCTGG - Intronic
1149437117 17:56642595-56642617 GTTCCTCCCACCAAAGAGGTGGG - Intergenic
1149605342 17:57920885-57920907 CTTCATCCTCCCAAAGTGTTGGG + Intronic
1150720289 17:67608762-67608784 GTTCATGCCTCCCAACGCTTTGG - Intronic
1152171993 17:78757282-78757304 GGTCATCCCCCCAAAGGATGAGG - Intronic
1152969476 18:147906-147928 TTTCATCCTTCCAAAGTGCTAGG - Intergenic
1155035957 18:22025260-22025282 CTTCAGCCTTCCAAAGTGTTGGG + Intergenic
1155176112 18:23302687-23302709 GTGCATTCCACCAAAGGGCTGGG - Intronic
1156347320 18:36269437-36269459 GTTCCTCCCTCGATAGGATTTGG - Exonic
1157887975 18:51387020-51387042 CTGCAGCCCTCCAAAGTGTTGGG + Intergenic
1158004037 18:52651749-52651771 GTTCATGCCACCTAAGGGCTGGG - Intronic
1159361529 18:67410851-67410873 GTTCCTCCCTCCAGAAGCTTTGG - Intergenic
1162289179 19:9765816-9765838 CTTCAACCTCCCAAAGGGTTAGG - Intronic
1162293181 19:9793843-9793865 GATCTTCCTTCCAAAGTGTTAGG - Intergenic
1163460207 19:17432786-17432808 GTTCAGCCTCCCAAAGTGTTGGG + Intronic
1163487977 19:17600411-17600433 CCTCAGCCCTCCAAAGTGTTGGG - Intergenic
1163736975 19:18987710-18987732 ATTAATCCCCCCCAAGGGTTTGG - Intergenic
1164872979 19:31662126-31662148 GTTCAGCCCTCCAAAGTGCTGGG - Intergenic
1165522102 19:36322572-36322594 GTTCAAGCCTGCAATGGGTTGGG + Intergenic
1165962985 19:39551022-39551044 CTTCAGCCTTCCAAAGTGTTGGG + Intergenic
1166542605 19:43615345-43615367 CTTCAGCCCTCCAAAGTGCTGGG + Intronic
1166958535 19:46483126-46483148 GTTCATTCATACAAAGTGTTTGG + Intronic
1167923680 19:52805730-52805752 GCTCATCCTCCCAAAGTGTTGGG - Intronic
1168555081 19:57331560-57331582 GCTCAACCTTCCAAAGTGTTGGG + Intergenic
926853404 2:17226295-17226317 CTTCAGCCTTCCAAAGTGTTGGG - Intergenic
929842083 2:45477663-45477685 CCTCACCCCTCCAAAGTGTTGGG + Intronic
930840300 2:55837922-55837944 CTTCAGCCTTCCAAAGTGTTGGG + Intergenic
931352492 2:61503927-61503949 CTTCATCCTTCCAAAGTGCTGGG - Intronic
931446729 2:62333009-62333031 GTTCCTCCCTCCACAGTGTCAGG - Intergenic
932156561 2:69423368-69423390 CTTCAGCCTTCCAAAGTGTTAGG + Intronic
938778933 2:134567094-134567116 GTACATCCCTCCATATGCTTCGG + Intronic
941356968 2:164505434-164505456 CTTGATCCCACCAAAGGTTTCGG - Intronic
946060744 2:216939341-216939363 CTTCAGCCTCCCAAAGGGTTGGG - Intergenic
946090847 2:217221810-217221832 GCTATTCCCTCCAAAGGATTAGG - Intergenic
947798314 2:232908225-232908247 GTTCATCCCAGCAAAAAGTTAGG - Intronic
1170648660 20:18219310-18219332 CTTCAGCCCTCCAAAGTGTTGGG - Intergenic
1172248111 20:33459995-33460017 CTTCATCCTTCCAAAATGTTGGG - Intergenic
1172448838 20:35007693-35007715 GTTCAGTTCTCCAAGGGGTTGGG + Intronic
1172545275 20:35756023-35756045 GCTCATCCTTCCAAAGTGTTGGG - Intergenic
1173624199 20:44459644-44459666 CTTCAGCCTTCCAAAGTGTTGGG - Intronic
1174465207 20:50712022-50712044 GATCCTCCTTCCAAAGTGTTGGG + Intergenic
1175609351 20:60337475-60337497 CTTCATTCCTCCGCAGGGTTTGG + Intergenic
1179405645 21:41123236-41123258 GGTCATCCCTCCATAAGGGTTGG - Intergenic
1182109354 22:27711805-27711827 CTTCAGCCCTCCAAAGTGCTGGG + Intergenic
1183822549 22:40358331-40358353 CTTCAGCCTTCCAAAGTGTTGGG - Intronic
950223828 3:11217277-11217299 CCTCAGCCCTCCAAAGGGCTGGG - Intronic
952170612 3:30802847-30802869 CCTCAGCCCTCCAAAGCGTTGGG - Intronic
952426529 3:33180574-33180596 CTTCAGCCTTCCAAAGTGTTGGG - Intronic
954768293 3:52941654-52941676 GTTCCTCCTTTCAAAGTGTTGGG - Intronic
954818860 3:53307197-53307219 CTTCAGCCTTCCAAAGTGTTGGG + Intronic
955218074 3:57001188-57001210 CTTCAGCCTTTCAAAGGGTTGGG + Intronic
956191863 3:66615649-66615671 TTTCATCCCTCCAAATGGTAAGG + Intergenic
957936703 3:86953329-86953351 GTGCAGCCCTCCAAAAGGATGGG - Intronic
960269992 3:115663006-115663028 TTTGATGGCTCCAAAGGGTTCGG + Intronic
960518040 3:118623712-118623734 CTTCGTCCTTCCAAAGTGTTGGG - Intergenic
961593749 3:128000286-128000308 TTTCAGCCCTCCAAAGTGCTGGG - Intergenic
964348904 3:155783403-155783425 CCTCATCCACCCAAAGGGTTGGG + Intronic
965591269 3:170362250-170362272 CTTCAGCCCCCCAAAGTGTTGGG - Intronic
967872775 3:194246036-194246058 GTTGGTGCCTCCAAAGGGCTTGG - Intergenic
968996767 4:3950795-3950817 GTCCTGCCCGCCAAAGGGTTTGG - Intergenic
969817195 4:9695446-9695468 GTCCTGCCCGCCAAAGGGTTTGG + Intergenic
969969530 4:11031550-11031572 GTTCAACCCTCGATATGGTTTGG - Intergenic
971642674 4:29156078-29156100 GTTCATCACTCAAGAAGGTTTGG - Intergenic
971734677 4:30431518-30431540 TTAGATCCCTCCAAAGGTTTTGG - Intergenic
972273103 4:37531345-37531367 GTTAATCAGTCCAAAGGGTATGG - Intronic
973333618 4:48934288-48934310 CCTCATCCCTCCAAAGTGCTGGG - Intergenic
974907650 4:68077653-68077675 GTTCTTGCCTACAAAGGATTGGG + Intronic
975130343 4:70826587-70826609 CTTCAGCCTTCCAAAGTGTTGGG - Intronic
976525939 4:86088434-86088456 CTTCAGCCTTCCAAAGTGTTGGG + Intronic
981505891 4:145499370-145499392 CTTCAGCCTCCCAAAGGGTTGGG - Intronic
991345317 5:65659731-65659753 CCTCAGCCTTCCAAAGGGTTAGG - Intronic
992051156 5:72942030-72942052 CTTCAGCCTTCCAAAGTGTTGGG - Intergenic
993714012 5:91256423-91256445 CTTCAGCCTTCCAAAGTGTTGGG + Intergenic
994032856 5:95165303-95165325 GTTTATCTCTCCAAAGTATTAGG - Intronic
994065729 5:95539591-95539613 CTTCAGCCCCCCAAAGTGTTGGG - Intronic
994784629 5:104141776-104141798 CCTCATCCTTCCAAAGTGTTGGG + Intergenic
997485954 5:134230915-134230937 GTTCATCACTCCAGAAGGCTGGG + Intergenic
998374612 5:141682334-141682356 GCGCAGGCCTCCAAAGGGTTTGG + Intergenic
1001200877 5:169715362-169715384 TTTCCTCCCTCCTAAGGGATGGG - Intronic
1002378324 5:178805175-178805197 GTTCAGCCTTCCAAAGTGCTGGG + Intergenic
1003327352 6:5102041-5102063 CTTCGTCCTTCCAAAGTGTTGGG + Intergenic
1004123465 6:12849444-12849466 ATTCATGTCTCCAAAGAGTTCGG - Intronic
1005753596 6:28905646-28905668 TTTCAGCCTTCCAAAGTGTTAGG + Intronic
1006233396 6:32605282-32605304 CTTCAGCCTTCCAAAGTGTTGGG - Intergenic
1006651703 6:35557023-35557045 CTTCAGCCTTCCAAAGTGTTGGG + Intergenic
1008972667 6:57387795-57387817 GTTCATCCATGCATAGGTTTGGG + Intronic
1009161574 6:60289353-60289375 GTTCATCCATGCATAGGTTTGGG + Intergenic
1009641871 6:66348857-66348879 ATTCAGCCTTCCAAAGTGTTGGG - Intergenic
1011134062 6:84080798-84080820 GTTCATGCCTCAAAACTGTTAGG - Intronic
1011615333 6:89192808-89192830 GATCAGCCTTCCAAAGGGCTGGG + Intronic
1013994647 6:116294271-116294293 GTTCAGCCTCCCAAAGTGTTGGG + Intronic
1014210570 6:118704188-118704210 TTTGATTCCTCCAAAGAGTTTGG - Intronic
1016060489 6:139625097-139625119 TTTCCTGCCTCCCAAGGGTTAGG - Intergenic
1016079050 6:139833601-139833623 GTTCACCCCTCCAGATGGTGGGG - Intergenic
1017234172 6:152102162-152102184 GTTCAGCCCTCAAAAGGCATGGG - Exonic
1017450059 6:154546699-154546721 GTTTATCCTTAAAAAGGGTTTGG - Intergenic
1018812942 6:167310628-167310650 GTTCATCCTCCCAAAGTGGTGGG - Intronic
1020510191 7:9046990-9047012 CTTCAGCCTTCCAAAGTGTTGGG - Intergenic
1022494059 7:30842316-30842338 GTTCAGCCCCACAAAGGGCTGGG + Intronic
1023594602 7:41815611-41815633 GTGATTCCCTCCAAAGGGCTTGG - Intergenic
1024802976 7:53102457-53102479 CCTCATCCTTCCAAAGTGTTGGG - Intergenic
1025220679 7:57104914-57104936 CTTCAGCCTTCCAAAGGGCTGGG - Intergenic
1025631494 7:63276726-63276748 CTTCAGCCTTCCAAAGGGCTGGG - Intergenic
1027529728 7:79315423-79315445 CCTCAGCCCTCCAAAGTGTTAGG + Intronic
1027569297 7:79843641-79843663 CTTCAGCCCTCCAAAGTGCTGGG - Intergenic
1029536049 7:101158482-101158504 GTTCTTCCCACCAAAGGCTGTGG - Intronic
1034749720 7:153557577-153557599 GTTCATGACTGCAAAGGCTTAGG - Intergenic
1035211101 7:157328728-157328750 ATTCAGCCTTCCAAAGTGTTGGG - Intergenic
1036380476 8:8233196-8233218 GTCCTGCCCACCAAAGGGTTTGG + Intergenic
1036849091 8:12189464-12189486 GTCCTGCCCACCAAAGGGTTTGG - Intronic
1036870452 8:12431738-12431760 GTCCTGCCCACCAAAGGGTTTGG - Intronic
1038943461 8:32331276-32331298 GTTCAGCCTTCCAAAGTGCTGGG - Intronic
1039805779 8:40996677-40996699 GCTCAACCTCCCAAAGGGTTGGG + Intergenic
1040375572 8:46821647-46821669 GTTAATGCCTCCTAAGAGTTGGG - Intergenic
1041250053 8:55925071-55925093 CTTCAGCCTTCCAAAGTGTTGGG + Intronic
1042823409 8:72956216-72956238 CTTCAGCCCACCAAAGTGTTGGG + Intergenic
1043440156 8:80269790-80269812 GTTCAGCCTTCCAAAGTGTTGGG - Intergenic
1045627177 8:104067640-104067662 CTTCAGCCCCCCAAAGTGTTGGG + Intronic
1053385426 9:37683611-37683633 GTTGTTCCCCCCAAAGGCTTTGG - Intronic
1056371972 9:85965375-85965397 CTTCATCCTTCCAAAGTGCTGGG - Intronic
1059487764 9:114639998-114640020 CTTCATCCTCCCAAAGTGTTAGG + Intronic
1059516866 9:114903859-114903881 TTTCATCCCTCCAAACACTTGGG - Exonic
1059763086 9:117357853-117357875 GTTCATCCCTCCAAAGGGTTAGG - Intronic
1060095525 9:120785777-120785799 GATCCACCCTCCAAAGTGTTGGG - Intronic
1060876132 9:127084770-127084792 GATCATCCCTGCAAAGGGCATGG - Intronic
1060977768 9:127775241-127775263 GCTCATCTTTCCAAAGTGTTGGG - Intronic
1061176404 9:129000205-129000227 GTTCAGCCTTCCAAAGTGTTGGG + Intronic
1061535742 9:131248733-131248755 CTTCATCCTCCCAAAGGGTTGGG - Intergenic
1062477781 9:136737535-136737557 GTTCAGCCCCCCAAAGTGCTGGG + Intergenic
1186705172 X:12133320-12133342 CTTCAGCCTTCCAAAGTGTTGGG + Intergenic
1188213077 X:27446283-27446305 CTTCAGCCTTCCATAGGGTTGGG + Intergenic
1200159502 X:153998784-153998806 CTTCAGCCTTCCAAAGTGTTGGG + Intergenic
1200176824 X:154122810-154122832 CTTCAGCCTCCCAAAGGGTTGGG - Intergenic