ID: 1059769585

View in Genome Browser
Species Human (GRCh38)
Location 9:117413793-117413815
Sequence AGGTGGGTAGAAAGGGAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059769574_1059769585 18 Left 1059769574 9:117413752-117413774 CCAGGGAGTGAGCTGCAAGGACA 0: 1
1: 0
2: 1
3: 14
4: 202
Right 1059769585 9:117413793-117413815 AGGTGGGTAGAAAGGGAAGGCGG No data
1059769573_1059769585 19 Left 1059769573 9:117413751-117413773 CCCAGGGAGTGAGCTGCAAGGAC 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1059769585 9:117413793-117413815 AGGTGGGTAGAAAGGGAAGGCGG No data
1059769579_1059769585 -7 Left 1059769579 9:117413777-117413799 CCGGCTCTCTGCCTGGAGGTGGG 0: 1
1: 0
2: 3
3: 60
4: 432
Right 1059769585 9:117413793-117413815 AGGTGGGTAGAAAGGGAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059769585 Original CRISPR AGGTGGGTAGAAAGGGAAGG CGG Intronic
No off target data available for this crispr