ID: 1059769891

View in Genome Browser
Species Human (GRCh38)
Location 9:117414981-117415003
Sequence GGCGGTGGCGAAGGAGGAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2286
Summary {0: 1, 1: 0, 2: 6, 3: 212, 4: 2067}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059769878_1059769891 23 Left 1059769878 9:117414935-117414957 CCATGGCGGGAGGGGCTGCGGTG 0: 1
1: 1
2: 0
3: 77
4: 1266
Right 1059769891 9:117414981-117415003 GGCGGTGGCGAAGGAGGAAGAGG 0: 1
1: 0
2: 6
3: 212
4: 2067

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059769891 Original CRISPR GGCGGTGGCGAAGGAGGAAG AGG Exonic