ID: 1059769891 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:117414981-117415003 |
| Sequence | GGCGGTGGCGAAGGAGGAAG AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2286 | |||
| Summary | {0: 1, 1: 0, 2: 6, 3: 212, 4: 2067} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1059769878_1059769891 | 23 | Left | 1059769878 | 9:117414935-117414957 | CCATGGCGGGAGGGGCTGCGGTG | 0: 1 1: 1 2: 0 3: 77 4: 1266 |
||
| Right | 1059769891 | 9:117414981-117415003 | GGCGGTGGCGAAGGAGGAAGAGG | 0: 1 1: 0 2: 6 3: 212 4: 2067 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1059769891 | Original CRISPR | GGCGGTGGCGAAGGAGGAAG AGG | Exonic | ||