ID: 1059776777

View in Genome Browser
Species Human (GRCh38)
Location 9:117484083-117484105
Sequence ACCTTGGTCAACTCTGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059776777_1059776783 18 Left 1059776777 9:117484083-117484105 CCTCTGGCAGAGTTGACCAAGGT No data
Right 1059776783 9:117484124-117484146 ATCCTAATTAGAAGTGGGCGGGG No data
1059776777_1059776789 25 Left 1059776777 9:117484083-117484105 CCTCTGGCAGAGTTGACCAAGGT No data
Right 1059776789 9:117484131-117484153 TTAGAAGTGGGCGGGGGGGTGGG No data
1059776777_1059776781 16 Left 1059776777 9:117484083-117484105 CCTCTGGCAGAGTTGACCAAGGT No data
Right 1059776781 9:117484122-117484144 ACATCCTAATTAGAAGTGGGCGG No data
1059776777_1059776790 26 Left 1059776777 9:117484083-117484105 CCTCTGGCAGAGTTGACCAAGGT No data
Right 1059776790 9:117484132-117484154 TAGAAGTGGGCGGGGGGGTGGGG No data
1059776777_1059776782 17 Left 1059776777 9:117484083-117484105 CCTCTGGCAGAGTTGACCAAGGT No data
Right 1059776782 9:117484123-117484145 CATCCTAATTAGAAGTGGGCGGG No data
1059776777_1059776788 24 Left 1059776777 9:117484083-117484105 CCTCTGGCAGAGTTGACCAAGGT No data
Right 1059776788 9:117484130-117484152 ATTAGAAGTGGGCGGGGGGGTGG No data
1059776777_1059776787 21 Left 1059776777 9:117484083-117484105 CCTCTGGCAGAGTTGACCAAGGT No data
Right 1059776787 9:117484127-117484149 CTAATTAGAAGTGGGCGGGGGGG No data
1059776777_1059776784 19 Left 1059776777 9:117484083-117484105 CCTCTGGCAGAGTTGACCAAGGT No data
Right 1059776784 9:117484125-117484147 TCCTAATTAGAAGTGGGCGGGGG No data
1059776777_1059776779 12 Left 1059776777 9:117484083-117484105 CCTCTGGCAGAGTTGACCAAGGT No data
Right 1059776779 9:117484118-117484140 ACTAACATCCTAATTAGAAGTGG No data
1059776777_1059776780 13 Left 1059776777 9:117484083-117484105 CCTCTGGCAGAGTTGACCAAGGT No data
Right 1059776780 9:117484119-117484141 CTAACATCCTAATTAGAAGTGGG No data
1059776777_1059776786 20 Left 1059776777 9:117484083-117484105 CCTCTGGCAGAGTTGACCAAGGT No data
Right 1059776786 9:117484126-117484148 CCTAATTAGAAGTGGGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059776777 Original CRISPR ACCTTGGTCAACTCTGCCAG AGG (reversed) Intergenic
No off target data available for this crispr