ID: 1059776782

View in Genome Browser
Species Human (GRCh38)
Location 9:117484123-117484145
Sequence CATCCTAATTAGAAGTGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059776778_1059776782 1 Left 1059776778 9:117484099-117484121 CCAAGGTCGTATAGTAGTCACTA No data
Right 1059776782 9:117484123-117484145 CATCCTAATTAGAAGTGGGCGGG No data
1059776777_1059776782 17 Left 1059776777 9:117484083-117484105 CCTCTGGCAGAGTTGACCAAGGT No data
Right 1059776782 9:117484123-117484145 CATCCTAATTAGAAGTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059776782 Original CRISPR CATCCTAATTAGAAGTGGGC GGG Intergenic
No off target data available for this crispr