ID: 1059776900

View in Genome Browser
Species Human (GRCh38)
Location 9:117485108-117485130
Sequence CTACATTAGCATGGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059776900_1059776906 -3 Left 1059776900 9:117485108-117485130 CCATCCACCCCATGCTAATGTAG No data
Right 1059776906 9:117485128-117485150 TAGCCCAGCCAAGGTAGAGATGG No data
1059776900_1059776912 27 Left 1059776900 9:117485108-117485130 CCATCCACCCCATGCTAATGTAG No data
Right 1059776912 9:117485158-117485180 CCCGTGTTTCAGCAAAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059776900 Original CRISPR CTACATTAGCATGGGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr