ID: 1059779150

View in Genome Browser
Species Human (GRCh38)
Location 9:117508201-117508223
Sequence GGGGGCAGAATGATTAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059779140_1059779150 20 Left 1059779140 9:117508158-117508180 CCTTAGAGAAATGCAGAGCCACC No data
Right 1059779150 9:117508201-117508223 GGGGGCAGAATGATTAAGATGGG No data
1059779146_1059779150 -4 Left 1059779146 9:117508182-117508204 CCAACTGAAGTGTTCAGGTGGGG No data
Right 1059779150 9:117508201-117508223 GGGGGCAGAATGATTAAGATGGG No data
1059779141_1059779150 2 Left 1059779141 9:117508176-117508198 CCACCACCAACTGAAGTGTTCAG No data
Right 1059779150 9:117508201-117508223 GGGGGCAGAATGATTAAGATGGG No data
1059779143_1059779150 -1 Left 1059779143 9:117508179-117508201 CCACCAACTGAAGTGTTCAGGTG No data
Right 1059779150 9:117508201-117508223 GGGGGCAGAATGATTAAGATGGG No data
1059779139_1059779150 23 Left 1059779139 9:117508155-117508177 CCTCCTTAGAGAAATGCAGAGCC No data
Right 1059779150 9:117508201-117508223 GGGGGCAGAATGATTAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059779150 Original CRISPR GGGGGCAGAATGATTAAGAT GGG Intergenic
No off target data available for this crispr