ID: 1059779788

View in Genome Browser
Species Human (GRCh38)
Location 9:117514357-117514379
Sequence CTGGCCCAACAACTGGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059779782_1059779788 30 Left 1059779782 9:117514304-117514326 CCCTTATTATTCTGAAATCCTTT No data
Right 1059779788 9:117514357-117514379 CTGGCCCAACAACTGGAGTTTGG No data
1059779784_1059779788 12 Left 1059779784 9:117514322-117514344 CCTTTAATTTTATAAAACAACAA No data
Right 1059779788 9:117514357-117514379 CTGGCCCAACAACTGGAGTTTGG No data
1059779783_1059779788 29 Left 1059779783 9:117514305-117514327 CCTTATTATTCTGAAATCCTTTA No data
Right 1059779788 9:117514357-117514379 CTGGCCCAACAACTGGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059779788 Original CRISPR CTGGCCCAACAACTGGAGTT TGG Intergenic
No off target data available for this crispr