ID: 1059780554

View in Genome Browser
Species Human (GRCh38)
Location 9:117521873-117521895
Sequence AGCCATAAACAGAGGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059780554_1059780557 0 Left 1059780554 9:117521873-117521895 CCCAGCTTCCTCTGTTTATGGCT No data
Right 1059780557 9:117521896-117521918 TTTTTGCTATGCCCGCCTGCTGG No data
1059780554_1059780561 15 Left 1059780554 9:117521873-117521895 CCCAGCTTCCTCTGTTTATGGCT No data
Right 1059780561 9:117521911-117521933 CCTGCTGGCCCCAAGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059780554 Original CRISPR AGCCATAAACAGAGGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr