ID: 1059781537

View in Genome Browser
Species Human (GRCh38)
Location 9:117533482-117533504
Sequence CTTTAGGGGCCTTGGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059781537_1059781544 -3 Left 1059781537 9:117533482-117533504 CCCAGCTGCCAAGGCCCCTAAAG No data
Right 1059781544 9:117533502-117533524 AAGATAGATGGCCCGTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059781537 Original CRISPR CTTTAGGGGCCTTGGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr