ID: 1059785689

View in Genome Browser
Species Human (GRCh38)
Location 9:117580755-117580777
Sequence AGCTTTTTTAAAGGTGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059785685_1059785689 -7 Left 1059785685 9:117580739-117580761 CCCGTGGTCCATTTTGAGCTTTT No data
Right 1059785689 9:117580755-117580777 AGCTTTTTTAAAGGTGTGTGTGG No data
1059785686_1059785689 -8 Left 1059785686 9:117580740-117580762 CCGTGGTCCATTTTGAGCTTTTT No data
Right 1059785689 9:117580755-117580777 AGCTTTTTTAAAGGTGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059785689 Original CRISPR AGCTTTTTTAAAGGTGTGTG TGG Intergenic
No off target data available for this crispr