ID: 1059786752

View in Genome Browser
Species Human (GRCh38)
Location 9:117594439-117594461
Sequence CTGTATCAGCAGGAGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059786743_1059786752 30 Left 1059786743 9:117594386-117594408 CCAGGCTGCCAAATTCCCCGTGG No data
Right 1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG No data
1059786745_1059786752 22 Left 1059786745 9:117594394-117594416 CCAAATTCCCCGTGGCCAAAAAC No data
Right 1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG No data
1059786748_1059786752 13 Left 1059786748 9:117594403-117594425 CCGTGGCCAAAAACACACAGCAA No data
Right 1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG No data
1059786749_1059786752 7 Left 1059786749 9:117594409-117594431 CCAAAAACACACAGCAAGACCTT No data
Right 1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG No data
1059786747_1059786752 14 Left 1059786747 9:117594402-117594424 CCCGTGGCCAAAAACACACAGCA No data
Right 1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG No data
1059786746_1059786752 15 Left 1059786746 9:117594401-117594423 CCCCGTGGCCAAAAACACACAGC No data
Right 1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059786752 Original CRISPR CTGTATCAGCAGGAGAAGAA AGG Intergenic
No off target data available for this crispr