ID: 1059789995

View in Genome Browser
Species Human (GRCh38)
Location 9:117631560-117631582
Sequence CTTTGTGAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270574
Summary {0: 8, 1: 1404, 2: 26762, 3: 81732, 4: 160668}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059789989_1059789995 11 Left 1059789989 9:117631526-117631548 CCGAATGCAGTTGCTCATGCCTG No data
Right 1059789995 9:117631560-117631582 CTTTGTGAGGCCAAGGTGGAAGG 0: 8
1: 1404
2: 26762
3: 81732
4: 160668
1059789990_1059789995 -8 Left 1059789990 9:117631545-117631567 CCTGTAATCCAAGCACTTTGTGA 0: 16
1: 3708
2: 324279
3: 264481
4: 138735
Right 1059789995 9:117631560-117631582 CTTTGTGAGGCCAAGGTGGAAGG 0: 8
1: 1404
2: 26762
3: 81732
4: 160668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059789995 Original CRISPR CTTTGTGAGGCCAAGGTGGA AGG Intergenic
Too many off-targets to display for this crispr