ID: 1059792377

View in Genome Browser
Species Human (GRCh38)
Location 9:117654075-117654097
Sequence CAGAAGTTCCTGAGGGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059792377_1059792381 9 Left 1059792377 9:117654075-117654097 CCGTGTTCCCTCAGGAACTTCTG No data
Right 1059792381 9:117654107-117654129 ACAGCAGAATTTCCCACAGATGG No data
1059792377_1059792384 28 Left 1059792377 9:117654075-117654097 CCGTGTTCCCTCAGGAACTTCTG No data
Right 1059792384 9:117654126-117654148 ATGGCCAAAAAGACATTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059792377 Original CRISPR CAGAAGTTCCTGAGGGAACA CGG (reversed) Intergenic
No off target data available for this crispr