ID: 1059792947

View in Genome Browser
Species Human (GRCh38)
Location 9:117660410-117660432
Sequence CTGCCTCCACAGAGGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059792947_1059792950 4 Left 1059792947 9:117660410-117660432 CCATGCTGCCTCTGTGGAGGCAG No data
Right 1059792950 9:117660437-117660459 AACTTGCCTCATGTTTAAGAAGG No data
1059792947_1059792955 25 Left 1059792947 9:117660410-117660432 CCATGCTGCCTCTGTGGAGGCAG No data
Right 1059792955 9:117660458-117660480 GGGCCGGAAGATTCACCAAAGGG No data
1059792947_1059792954 24 Left 1059792947 9:117660410-117660432 CCATGCTGCCTCTGTGGAGGCAG No data
Right 1059792954 9:117660457-117660479 AGGGCCGGAAGATTCACCAAAGG No data
1059792947_1059792951 5 Left 1059792947 9:117660410-117660432 CCATGCTGCCTCTGTGGAGGCAG No data
Right 1059792951 9:117660438-117660460 ACTTGCCTCATGTTTAAGAAGGG No data
1059792947_1059792952 9 Left 1059792947 9:117660410-117660432 CCATGCTGCCTCTGTGGAGGCAG No data
Right 1059792952 9:117660442-117660464 GCCTCATGTTTAAGAAGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059792947 Original CRISPR CTGCCTCCACAGAGGCAGCA TGG (reversed) Intergenic
No off target data available for this crispr