ID: 1059792949

View in Genome Browser
Species Human (GRCh38)
Location 9:117660418-117660440
Sequence AGTTCTACCTGCCTCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059792949_1059792952 1 Left 1059792949 9:117660418-117660440 CCTCTGTGGAGGCAGGTAGAACT No data
Right 1059792952 9:117660442-117660464 GCCTCATGTTTAAGAAGGGCCGG No data
1059792949_1059792955 17 Left 1059792949 9:117660418-117660440 CCTCTGTGGAGGCAGGTAGAACT No data
Right 1059792955 9:117660458-117660480 GGGCCGGAAGATTCACCAAAGGG No data
1059792949_1059792950 -4 Left 1059792949 9:117660418-117660440 CCTCTGTGGAGGCAGGTAGAACT No data
Right 1059792950 9:117660437-117660459 AACTTGCCTCATGTTTAAGAAGG No data
1059792949_1059792951 -3 Left 1059792949 9:117660418-117660440 CCTCTGTGGAGGCAGGTAGAACT No data
Right 1059792951 9:117660438-117660460 ACTTGCCTCATGTTTAAGAAGGG No data
1059792949_1059792954 16 Left 1059792949 9:117660418-117660440 CCTCTGTGGAGGCAGGTAGAACT No data
Right 1059792954 9:117660457-117660479 AGGGCCGGAAGATTCACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059792949 Original CRISPR AGTTCTACCTGCCTCCACAG AGG (reversed) Intergenic
No off target data available for this crispr