ID: 1059792950

View in Genome Browser
Species Human (GRCh38)
Location 9:117660437-117660459
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059792947_1059792950 4 Left 1059792947 9:117660410-117660432 CCATGCTGCCTCTGTGGAGGCAG No data
Right 1059792950 9:117660437-117660459 AACTTGCCTCATGTTTAAGAAGG No data
1059792949_1059792950 -4 Left 1059792949 9:117660418-117660440 CCTCTGTGGAGGCAGGTAGAACT No data
Right 1059792950 9:117660437-117660459 AACTTGCCTCATGTTTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059792950 Original CRISPR AACTTGCCTCATGTTTAAGA AGG Intergenic
No off target data available for this crispr