ID: 1059792951

View in Genome Browser
Species Human (GRCh38)
Location 9:117660438-117660460
Sequence ACTTGCCTCATGTTTAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059792949_1059792951 -3 Left 1059792949 9:117660418-117660440 CCTCTGTGGAGGCAGGTAGAACT No data
Right 1059792951 9:117660438-117660460 ACTTGCCTCATGTTTAAGAAGGG No data
1059792947_1059792951 5 Left 1059792947 9:117660410-117660432 CCATGCTGCCTCTGTGGAGGCAG No data
Right 1059792951 9:117660438-117660460 ACTTGCCTCATGTTTAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059792951 Original CRISPR ACTTGCCTCATGTTTAAGAA GGG Intergenic
No off target data available for this crispr