ID: 1059792955

View in Genome Browser
Species Human (GRCh38)
Location 9:117660458-117660480
Sequence GGGCCGGAAGATTCACCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059792949_1059792955 17 Left 1059792949 9:117660418-117660440 CCTCTGTGGAGGCAGGTAGAACT No data
Right 1059792955 9:117660458-117660480 GGGCCGGAAGATTCACCAAAGGG No data
1059792947_1059792955 25 Left 1059792947 9:117660410-117660432 CCATGCTGCCTCTGTGGAGGCAG No data
Right 1059792955 9:117660458-117660480 GGGCCGGAAGATTCACCAAAGGG No data
1059792953_1059792955 -8 Left 1059792953 9:117660443-117660465 CCTCATGTTTAAGAAGGGCCGGA No data
Right 1059792955 9:117660458-117660480 GGGCCGGAAGATTCACCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059792955 Original CRISPR GGGCCGGAAGATTCACCAAA GGG Intergenic
No off target data available for this crispr