ID: 1059801118

View in Genome Browser
Species Human (GRCh38)
Location 9:117750485-117750507
Sequence CTGTACTTGGAGAGGAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059801118_1059801126 22 Left 1059801118 9:117750485-117750507 CCATCTTTCCTCTCCAAGTACAG No data
Right 1059801126 9:117750530-117750552 GTGCTCCCTGCCTATCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059801118 Original CRISPR CTGTACTTGGAGAGGAAAGA TGG (reversed) Intergenic
No off target data available for this crispr