ID: 1059802291

View in Genome Browser
Species Human (GRCh38)
Location 9:117762718-117762740
Sequence GTGGTCTGGAGTAAAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059802285_1059802291 6 Left 1059802285 9:117762689-117762711 CCTACTTGCATAACAGATTTTGG No data
Right 1059802291 9:117762718-117762740 GTGGTCTGGAGTAAAGAAGCAGG No data
1059802284_1059802291 21 Left 1059802284 9:117762674-117762696 CCAAATAGTTTGATACCTACTTG No data
Right 1059802291 9:117762718-117762740 GTGGTCTGGAGTAAAGAAGCAGG No data
1059802283_1059802291 24 Left 1059802283 9:117762671-117762693 CCTCCAAATAGTTTGATACCTAC No data
Right 1059802291 9:117762718-117762740 GTGGTCTGGAGTAAAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059802291 Original CRISPR GTGGTCTGGAGTAAAGAAGC AGG Intergenic
No off target data available for this crispr