ID: 1059802457

View in Genome Browser
Species Human (GRCh38)
Location 9:117763982-117764004
Sequence GATGGGGGTAGGGGAGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059802457_1059802465 -2 Left 1059802457 9:117763982-117764004 CCTGACACTCCCCTACCCCCATC No data
Right 1059802465 9:117764003-117764025 TCATGCCAGTATCGATCACTTGG No data
1059802457_1059802469 12 Left 1059802457 9:117763982-117764004 CCTGACACTCCCCTACCCCCATC No data
Right 1059802469 9:117764017-117764039 ATCACTTGGATACTTACTTGGGG No data
1059802457_1059802467 10 Left 1059802457 9:117763982-117764004 CCTGACACTCCCCTACCCCCATC No data
Right 1059802467 9:117764015-117764037 CGATCACTTGGATACTTACTTGG No data
1059802457_1059802468 11 Left 1059802457 9:117763982-117764004 CCTGACACTCCCCTACCCCCATC No data
Right 1059802468 9:117764016-117764038 GATCACTTGGATACTTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059802457 Original CRISPR GATGGGGGTAGGGGAGTGTC AGG (reversed) Intergenic
No off target data available for this crispr