ID: 1059803034

View in Genome Browser
Species Human (GRCh38)
Location 9:117770288-117770310
Sequence CAGCTCTGAAAGAGGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059803029_1059803034 8 Left 1059803029 9:117770257-117770279 CCAAGTCTGGTGGACCAGAGACA No data
Right 1059803034 9:117770288-117770310 CAGCTCTGAAAGAGGACAAAGGG No data
1059803031_1059803034 -6 Left 1059803031 9:117770271-117770293 CCAGAGACATCGTGAGGCAGCTC No data
Right 1059803034 9:117770288-117770310 CAGCTCTGAAAGAGGACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059803034 Original CRISPR CAGCTCTGAAAGAGGACAAA GGG Intergenic
No off target data available for this crispr