ID: 1059803668

View in Genome Browser
Species Human (GRCh38)
Location 9:117775580-117775602
Sequence CCCAGGGGCTTGAGGGCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059803658_1059803668 30 Left 1059803658 9:117775527-117775549 CCAACAACATCTAAAATGTTCAT No data
Right 1059803668 9:117775580-117775602 CCCAGGGGCTTGAGGGCAATGGG No data
1059803660_1059803668 -3 Left 1059803660 9:117775560-117775582 CCTTGAGCTAATTATGGTTACCC No data
Right 1059803668 9:117775580-117775602 CCCAGGGGCTTGAGGGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059803668 Original CRISPR CCCAGGGGCTTGAGGGCAAT GGG Intergenic
No off target data available for this crispr