ID: 1059803723

View in Genome Browser
Species Human (GRCh38)
Location 9:117775992-117776014
Sequence CCTTCAAAGCCCACTCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059803716_1059803723 16 Left 1059803716 9:117775953-117775975 CCCATATGTAGAATGCTTCCACA No data
Right 1059803723 9:117775992-117776014 CCTTCAAAGCCCACTCCAAATGG No data
1059803715_1059803723 17 Left 1059803715 9:117775952-117775974 CCCCATATGTAGAATGCTTCCAC No data
Right 1059803723 9:117775992-117776014 CCTTCAAAGCCCACTCCAAATGG No data
1059803718_1059803723 -2 Left 1059803718 9:117775971-117775993 CCACATGCAAATCTCTCCCCTCC No data
Right 1059803723 9:117775992-117776014 CCTTCAAAGCCCACTCCAAATGG No data
1059803717_1059803723 15 Left 1059803717 9:117775954-117775976 CCATATGTAGAATGCTTCCACAT No data
Right 1059803723 9:117775992-117776014 CCTTCAAAGCCCACTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059803723 Original CRISPR CCTTCAAAGCCCACTCCAAA TGG Intergenic
No off target data available for this crispr