ID: 1059806510

View in Genome Browser
Species Human (GRCh38)
Location 9:117806850-117806872
Sequence ACTAGACTAAAGGCAGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059806510_1059806513 4 Left 1059806510 9:117806850-117806872 CCAAATCCTGCCTTTAGTCTAGT No data
Right 1059806513 9:117806877-117806899 CATTGTCTTTGAGAGAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059806510 Original CRISPR ACTAGACTAAAGGCAGGATT TGG (reversed) Intergenic
No off target data available for this crispr