ID: 1059807222

View in Genome Browser
Species Human (GRCh38)
Location 9:117815478-117815500
Sequence CACCCAGGTCAAACCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059807222_1059807225 21 Left 1059807222 9:117815478-117815500 CCTCTGTGGGTTTGACCTGGGTG No data
Right 1059807225 9:117815522-117815544 AGAAAGCCAGCCCCATATTTAGG No data
1059807222_1059807226 26 Left 1059807222 9:117815478-117815500 CCTCTGTGGGTTTGACCTGGGTG No data
Right 1059807226 9:117815527-117815549 GCCAGCCCCATATTTAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059807222 Original CRISPR CACCCAGGTCAAACCCACAG AGG (reversed) Intergenic
No off target data available for this crispr