ID: 1059808067

View in Genome Browser
Species Human (GRCh38)
Location 9:117826240-117826262
Sequence CAGAAGAAGGGGAAGTAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059808058_1059808067 -5 Left 1059808058 9:117826222-117826244 CCCCAAAACCACTAAGAACAGAA No data
Right 1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG No data
1059808057_1059808067 8 Left 1059808057 9:117826209-117826231 CCTTCTGTGAACTCCCCAAAACC No data
Right 1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG No data
1059808059_1059808067 -6 Left 1059808059 9:117826223-117826245 CCCAAAACCACTAAGAACAGAAG No data
Right 1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG No data
1059808060_1059808067 -7 Left 1059808060 9:117826224-117826246 CCAAAACCACTAAGAACAGAAGA No data
Right 1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059808067 Original CRISPR CAGAAGAAGGGGAAGTAGTG GGG Intergenic
No off target data available for this crispr