ID: 1059809103

View in Genome Browser
Species Human (GRCh38)
Location 9:117836212-117836234
Sequence AACTCTCTCTAGTCTCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059809099_1059809103 13 Left 1059809099 9:117836176-117836198 CCTCTCACCATAAAATGAATTCA No data
Right 1059809103 9:117836212-117836234 AACTCTCTCTAGTCTCTGGTTGG No data
1059809100_1059809103 6 Left 1059809100 9:117836183-117836205 CCATAAAATGAATTCAAGAAAAC No data
Right 1059809103 9:117836212-117836234 AACTCTCTCTAGTCTCTGGTTGG No data
1059809098_1059809103 16 Left 1059809098 9:117836173-117836195 CCACCTCTCACCATAAAATGAAT No data
Right 1059809103 9:117836212-117836234 AACTCTCTCTAGTCTCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059809103 Original CRISPR AACTCTCTCTAGTCTCTGGT TGG Intergenic
No off target data available for this crispr