ID: 1059811127

View in Genome Browser
Species Human (GRCh38)
Location 9:117856796-117856818
Sequence CGCAAGGCTCAGAGTGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059811127_1059811130 -6 Left 1059811127 9:117856796-117856818 CCATCACCACTCTGAGCCTTGCG No data
Right 1059811130 9:117856813-117856835 CTTGCGATATATTTGAATGAAGG No data
1059811127_1059811133 27 Left 1059811127 9:117856796-117856818 CCATCACCACTCTGAGCCTTGCG No data
Right 1059811133 9:117856846-117856868 TTGCAAGTCTTTTGTCTTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059811127 Original CRISPR CGCAAGGCTCAGAGTGGTGA TGG (reversed) Intergenic
No off target data available for this crispr