ID: 1059811570

View in Genome Browser
Species Human (GRCh38)
Location 9:117860998-117861020
Sequence ATGATTCAAGCAGGAAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059811570_1059811573 -10 Left 1059811570 9:117860998-117861020 CCTCCACTTCCTGCTTGAATCAT No data
Right 1059811573 9:117861011-117861033 CTTGAATCATTTCATATTTTTGG No data
1059811570_1059811575 12 Left 1059811570 9:117860998-117861020 CCTCCACTTCCTGCTTGAATCAT No data
Right 1059811575 9:117861033-117861055 GTTCAAACCAGTCAGCACCAGGG No data
1059811570_1059811578 30 Left 1059811570 9:117860998-117861020 CCTCCACTTCCTGCTTGAATCAT No data
Right 1059811578 9:117861051-117861073 CAGGGCTAAGTGACCTTTAGTGG No data
1059811570_1059811574 11 Left 1059811570 9:117860998-117861020 CCTCCACTTCCTGCTTGAATCAT No data
Right 1059811574 9:117861032-117861054 GGTTCAAACCAGTCAGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059811570 Original CRISPR ATGATTCAAGCAGGAAGTGG AGG (reversed) Intergenic
No off target data available for this crispr