ID: 1059811571

View in Genome Browser
Species Human (GRCh38)
Location 9:117861001-117861023
Sequence GAAATGATTCAAGCAGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059811571_1059811578 27 Left 1059811571 9:117861001-117861023 CCACTTCCTGCTTGAATCATTTC No data
Right 1059811578 9:117861051-117861073 CAGGGCTAAGTGACCTTTAGTGG No data
1059811571_1059811574 8 Left 1059811571 9:117861001-117861023 CCACTTCCTGCTTGAATCATTTC No data
Right 1059811574 9:117861032-117861054 GGTTCAAACCAGTCAGCACCAGG No data
1059811571_1059811575 9 Left 1059811571 9:117861001-117861023 CCACTTCCTGCTTGAATCATTTC No data
Right 1059811575 9:117861033-117861055 GTTCAAACCAGTCAGCACCAGGG No data
1059811571_1059811579 28 Left 1059811571 9:117861001-117861023 CCACTTCCTGCTTGAATCATTTC No data
Right 1059811579 9:117861052-117861074 AGGGCTAAGTGACCTTTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059811571 Original CRISPR GAAATGATTCAAGCAGGAAG TGG (reversed) Intergenic
No off target data available for this crispr