ID: 1059811572

View in Genome Browser
Species Human (GRCh38)
Location 9:117861007-117861029
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059811572_1059811578 21 Left 1059811572 9:117861007-117861029 CCTGCTTGAATCATTTCATATTT No data
Right 1059811578 9:117861051-117861073 CAGGGCTAAGTGACCTTTAGTGG No data
1059811572_1059811574 2 Left 1059811572 9:117861007-117861029 CCTGCTTGAATCATTTCATATTT No data
Right 1059811574 9:117861032-117861054 GGTTCAAACCAGTCAGCACCAGG No data
1059811572_1059811579 22 Left 1059811572 9:117861007-117861029 CCTGCTTGAATCATTTCATATTT No data
Right 1059811579 9:117861052-117861074 AGGGCTAAGTGACCTTTAGTGGG No data
1059811572_1059811575 3 Left 1059811572 9:117861007-117861029 CCTGCTTGAATCATTTCATATTT No data
Right 1059811575 9:117861033-117861055 GTTCAAACCAGTCAGCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059811572 Original CRISPR AAATATGAAATGATTCAAGC AGG (reversed) Intergenic