ID: 1059811575

View in Genome Browser
Species Human (GRCh38)
Location 9:117861033-117861055
Sequence GTTCAAACCAGTCAGCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059811571_1059811575 9 Left 1059811571 9:117861001-117861023 CCACTTCCTGCTTGAATCATTTC No data
Right 1059811575 9:117861033-117861055 GTTCAAACCAGTCAGCACCAGGG No data
1059811572_1059811575 3 Left 1059811572 9:117861007-117861029 CCTGCTTGAATCATTTCATATTT No data
Right 1059811575 9:117861033-117861055 GTTCAAACCAGTCAGCACCAGGG No data
1059811570_1059811575 12 Left 1059811570 9:117860998-117861020 CCTCCACTTCCTGCTTGAATCAT No data
Right 1059811575 9:117861033-117861055 GTTCAAACCAGTCAGCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059811575 Original CRISPR GTTCAAACCAGTCAGCACCA GGG Intergenic
No off target data available for this crispr