ID: 1059811578

View in Genome Browser
Species Human (GRCh38)
Location 9:117861051-117861073
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059811572_1059811578 21 Left 1059811572 9:117861007-117861029 CCTGCTTGAATCATTTCATATTT No data
Right 1059811578 9:117861051-117861073 CAGGGCTAAGTGACCTTTAGTGG No data
1059811571_1059811578 27 Left 1059811571 9:117861001-117861023 CCACTTCCTGCTTGAATCATTTC No data
Right 1059811578 9:117861051-117861073 CAGGGCTAAGTGACCTTTAGTGG No data
1059811570_1059811578 30 Left 1059811570 9:117860998-117861020 CCTCCACTTCCTGCTTGAATCAT No data
Right 1059811578 9:117861051-117861073 CAGGGCTAAGTGACCTTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059811578 Original CRISPR CAGGGCTAAGTGACCTTTAG TGG Intergenic