ID: 1059814758

View in Genome Browser
Species Human (GRCh38)
Location 9:117900011-117900033
Sequence TAGAATCTATAGATGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059814758_1059814762 13 Left 1059814758 9:117900011-117900033 CCAAATTCCATCTATAGATTCTA No data
Right 1059814762 9:117900047-117900069 AGTCAATGAAATCTCTGAATGGG No data
1059814758_1059814761 12 Left 1059814758 9:117900011-117900033 CCAAATTCCATCTATAGATTCTA No data
Right 1059814761 9:117900046-117900068 GAGTCAATGAAATCTCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059814758 Original CRISPR TAGAATCTATAGATGGAATT TGG (reversed) Intergenic
No off target data available for this crispr