ID: 1059819029

View in Genome Browser
Species Human (GRCh38)
Location 9:117951242-117951264
Sequence TGTGCTTTAGCAGAGCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059819029_1059819033 14 Left 1059819029 9:117951242-117951264 CCCACCCGCTCTGCTAAAGCACA No data
Right 1059819033 9:117951279-117951301 AAAAGCCATTTTCTATCCAAAGG No data
1059819029_1059819035 21 Left 1059819029 9:117951242-117951264 CCCACCCGCTCTGCTAAAGCACA No data
Right 1059819035 9:117951286-117951308 ATTTTCTATCCAAAGGCAGCTGG No data
1059819029_1059819037 30 Left 1059819029 9:117951242-117951264 CCCACCCGCTCTGCTAAAGCACA No data
Right 1059819037 9:117951295-117951317 CCAAAGGCAGCTGGTTGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059819029 Original CRISPR TGTGCTTTAGCAGAGCGGGT GGG (reversed) Intergenic
No off target data available for this crispr