ID: 1059824286

View in Genome Browser
Species Human (GRCh38)
Location 9:118009721-118009743
Sequence AACTCAGGAATGGTAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059824286_1059824295 25 Left 1059824286 9:118009721-118009743 CCCTCCACTACCATTCCTGAGTT No data
Right 1059824295 9:118009769-118009791 CCCTCTCACTCAGCCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059824286 Original CRISPR AACTCAGGAATGGTAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr