ID: 1059824295

View in Genome Browser
Species Human (GRCh38)
Location 9:118009769-118009791
Sequence CCCTCTCACTCAGCCTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059824290_1059824295 10 Left 1059824290 9:118009736-118009758 CCTGAGTTCACTACTTCCCAAGC No data
Right 1059824295 9:118009769-118009791 CCCTCTCACTCAGCCTCCCCTGG No data
1059824288_1059824295 21 Left 1059824288 9:118009725-118009747 CCACTACCATTCCTGAGTTCACT No data
Right 1059824295 9:118009769-118009791 CCCTCTCACTCAGCCTCCCCTGG No data
1059824291_1059824295 -6 Left 1059824291 9:118009752-118009774 CCCAAGCCTCAGAAGTACCCTCT No data
Right 1059824295 9:118009769-118009791 CCCTCTCACTCAGCCTCCCCTGG No data
1059824287_1059824295 24 Left 1059824287 9:118009722-118009744 CCTCCACTACCATTCCTGAGTTC No data
Right 1059824295 9:118009769-118009791 CCCTCTCACTCAGCCTCCCCTGG No data
1059824286_1059824295 25 Left 1059824286 9:118009721-118009743 CCCTCCACTACCATTCCTGAGTT No data
Right 1059824295 9:118009769-118009791 CCCTCTCACTCAGCCTCCCCTGG No data
1059824285_1059824295 26 Left 1059824285 9:118009720-118009742 CCCCTCCACTACCATTCCTGAGT No data
Right 1059824295 9:118009769-118009791 CCCTCTCACTCAGCCTCCCCTGG No data
1059824289_1059824295 15 Left 1059824289 9:118009731-118009753 CCATTCCTGAGTTCACTACTTCC No data
Right 1059824295 9:118009769-118009791 CCCTCTCACTCAGCCTCCCCTGG No data
1059824292_1059824295 -7 Left 1059824292 9:118009753-118009775 CCAAGCCTCAGAAGTACCCTCTC No data
Right 1059824295 9:118009769-118009791 CCCTCTCACTCAGCCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059824295 Original CRISPR CCCTCTCACTCAGCCTCCCC TGG Intergenic
No off target data available for this crispr